Incidental Mutation 'R4250:Olfr1447'
ID321323
Institutional Source Beutler Lab
Gene Symbol Olfr1447
Ensembl Gene ENSMUSG00000060303
Gene Nameolfactory receptor 1447
SynonymsGA_x6K02T2RE5P-3231251-3230331, MOR202-3
MMRRC Submission 041066-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R4250 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location12899434-12903743 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12901004 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 259 (M259V)
Ref Sequence ENSEMBL: ENSMUSP00000149392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071484] [ENSMUST00000208343] [ENSMUST00000216989]
Predicted Effect probably benign
Transcript: ENSMUST00000071484
AA Change: M259V

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000071419
Gene: ENSMUSG00000060303
AA Change: M259V

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 5.3e-50 PFAM
Pfam:7TM_GPCR_Srsx 36 306 2.1e-7 PFAM
Pfam:7tm_1 42 291 7.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208343
Predicted Effect probably benign
Transcript: ENSMUST00000216989
AA Change: M259V

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218013
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220222
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik C A 8: 36,512,212 T323K probably benign Het
Bcl2a1d C T 9: 88,731,653 V23I probably benign Het
Birc2 A T 9: 7,818,935 L552M probably benign Het
Chst3 A T 10: 60,186,068 L319Q probably damaging Het
Col19a1 T C 1: 24,525,645 T296A unknown Het
Colgalt2 A T 1: 152,489,887 I313L probably benign Het
Dclre1b A C 3: 103,804,084 probably null Het
Ezr A T 17: 6,754,797 I94N probably damaging Het
Fry T G 5: 150,310,360 I99S probably damaging Het
Hba-x T C 11: 32,278,000 Y155H probably damaging Het
Herc3 T A 6: 58,916,516 V921D probably damaging Het
Hoxb5 T C 11: 96,304,028 S139P possibly damaging Het
Icam5 A G 9: 21,037,739 T796A probably damaging Het
Igkv8-26 G A 6: 70,193,246 V7I probably benign Het
Ikzf1 C T 11: 11,754,166 T194M probably damaging Het
Kif14 G T 1: 136,473,388 M492I possibly damaging Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Padi2 A G 4: 140,906,546 Y38C probably damaging Het
Pilra A T 5: 137,823,552 S274T probably benign Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Rreb1 T C 13: 37,893,893 V27A possibly damaging Het
Rxfp1 A G 3: 79,652,272 V414A probably benign Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Sirt1 T A 10: 63,337,098 probably null Het
Slc5a6 A G 5: 31,037,718 S512P probably benign Het
Snx8 A G 5: 140,356,045 L121P probably damaging Het
Sp7 T A 15: 102,358,892 T160S possibly damaging Het
Tcte1 A G 17: 45,539,691 I298V probably benign Het
Ttc4 G A 4: 106,665,683 T346I probably damaging Het
Ttn T C 2: 76,713,712 T32977A probably damaging Het
Yeats2 A G 16: 20,156,935 K114E possibly damaging Het
Zdbf2 T C 1: 63,302,861 V133A possibly damaging Het
Other mutations in Olfr1447
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Olfr1447 APN 19 12901355 missense probably benign 0.40
IGL01704:Olfr1447 APN 19 12901739 missense probably benign 0.01
IGL01767:Olfr1447 APN 19 12901748 missense probably benign 0.12
IGL01969:Olfr1447 APN 19 12901052 missense possibly damaging 0.69
IGL02435:Olfr1447 APN 19 12901027 missense probably damaging 1.00
IGL02666:Olfr1447 APN 19 12900857 missense probably benign
IGL03034:Olfr1447 APN 19 12901757 missense possibly damaging 0.94
IGL03221:Olfr1447 APN 19 12901541 missense probably damaging 1.00
R0315:Olfr1447 UTSW 19 12901234 missense possibly damaging 0.66
R0550:Olfr1447 UTSW 19 12901800 splice site probably null
R0729:Olfr1447 UTSW 19 12900895 missense probably damaging 0.97
R1381:Olfr1447 UTSW 19 12900956 missense probably benign 0.00
R1669:Olfr1447 UTSW 19 12901288 missense possibly damaging 0.79
R1775:Olfr1447 UTSW 19 12901235 missense probably benign 0.02
R1918:Olfr1447 UTSW 19 12900851 makesense probably null
R2377:Olfr1447 UTSW 19 12900853 missense possibly damaging 0.45
R2406:Olfr1447 UTSW 19 12901627 missense probably benign 0.11
R2471:Olfr1447 UTSW 19 12901315 missense probably benign 0.00
R2484:Olfr1447 UTSW 19 12901641 missense probably benign 0.06
R2656:Olfr1447 UTSW 19 12901666 missense probably benign 0.37
R3888:Olfr1447 UTSW 19 12901133 missense probably benign 0.00
R4545:Olfr1447 UTSW 19 12901268 nonsense probably null
R4895:Olfr1447 UTSW 19 12900887 missense probably damaging 1.00
R4956:Olfr1447 UTSW 19 12901599 missense probably damaging 0.99
R4991:Olfr1447 UTSW 19 12901451 missense probably damaging 0.98
R5044:Olfr1447 UTSW 19 12901001 missense probably damaging 1.00
R5165:Olfr1447 UTSW 19 12901200 missense probably benign 0.00
R6025:Olfr1447 UTSW 19 12901670 missense probably benign 0.10
R6135:Olfr1447 UTSW 19 12901439 missense probably damaging 0.97
R6459:Olfr1447 UTSW 19 12901005 missense possibly damaging 0.94
R6733:Olfr1447 UTSW 19 12901241 missense probably damaging 1.00
R6789:Olfr1447 UTSW 19 12901289 missense probably benign 0.21
R6923:Olfr1447 UTSW 19 12901312 missense probably benign 0.04
R7310:Olfr1447 UTSW 19 12901273 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTAATTTAGTACAGGGAGGAGATC -3'
(R):5'- CCTGCAATCATGGCTCTCAC -3'

Sequencing Primer
(F):5'- TTAGTACAGGGAGGAGATCTGAGAAG -3'
(R):5'- GGCTCTCACTTGTTTTGATAATCAAG -3'
Posted On2015-06-12