Incidental Mutation 'R4105:Atg9a'
ID321327
Institutional Source Beutler Lab
Gene Symbol Atg9a
Ensembl Gene ENSMUSG00000033124
Gene Nameautophagy related 9A
SynonymsApg9l1
MMRRC Submission 040985-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4105 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location75180860-75192196 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75185959 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 471 (Y471H)
Ref Sequence ENSEMBL: ENSMUSP00000139641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040689] [ENSMUST00000186744] [ENSMUST00000188347] [ENSMUST00000189665] [ENSMUST00000189702]
Predicted Effect probably damaging
Transcript: ENSMUST00000040689
AA Change: Y471H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047449
Gene: ENSMUSG00000033124
AA Change: Y471H

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 173 530 3.4e-134 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185727
Predicted Effect probably benign
Transcript: ENSMUST00000186744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187601
Predicted Effect unknown
Transcript: ENSMUST00000187785
AA Change: Y30H
Predicted Effect probably damaging
Transcript: ENSMUST00000188347
AA Change: Y471H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139731
Gene: ENSMUSG00000033124
AA Change: Y471H

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 172 533 2.4e-140 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188430
Predicted Effect probably benign
Transcript: ENSMUST00000189665
SMART Domains Protein: ENSMUSP00000140012
Gene: ENSMUSG00000033124

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189702
AA Change: Y471H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139641
Gene: ENSMUSG00000033124
AA Change: Y471H

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 172 533 2.4e-140 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000189820
AA Change: Y463H
Meta Mutation Damage Score 0.41 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (46/48)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation all die within 1 day of birth and display impaired autophagy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adar T C 3: 89,740,094 S127P probably benign Het
Arhgap31 A G 16: 38,602,426 S1093P probably damaging Het
Asb18 T C 1: 89,968,521 S266G possibly damaging Het
Bmper G A 9: 23,224,763 V47I probably benign Het
Cel T C 2: 28,558,027 D329G probably benign Het
Ces2f T C 8: 104,951,192 probably null Het
Cyp2j7 T C 4: 96,199,450 T408A possibly damaging Het
Dchs1 A C 7: 105,765,140 S823A probably damaging Het
Dnajb2 G T 1: 75,236,899 E6* probably null Het
Eif2b3 G A 4: 117,081,634 G427R probably damaging Het
Eml5 T C 12: 98,841,548 probably null Het
Fam214a A G 9: 75,008,776 Q226R probably damaging Het
Fat1 A G 8: 45,036,851 Y3600C probably damaging Het
Fbxo10 A G 4: 45,059,054 F228L probably benign Het
Fgf7 T A 2: 126,035,679 probably benign Het
Gm2832 A T 14: 41,280,899 M122L unknown Het
Lrrcc1 T C 3: 14,550,328 V73A probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Naip5 T C 13: 100,219,739 R1123G probably benign Het
Nfya G T 17: 48,392,884 Y37* probably null Het
Olfr1394 A G 11: 49,160,548 H178R possibly damaging Het
Pikfyve A G 1: 65,190,520 probably benign Het
Pnmal1 T C 7: 16,961,179 S320P possibly damaging Het
Polr1a A G 6: 71,976,191 N1581S probably damaging Het
Polrmt G T 10: 79,741,733 T344K probably benign Het
Postn T C 3: 54,376,041 F514L probably damaging Het
Ptprq G T 10: 107,572,967 T1895N probably damaging Het
Slc15a2 G T 16: 36,782,393 probably benign Het
Slco2a1 T A 9: 103,067,876 L150Q probably benign Het
Slco2a1 T C 9: 103,073,250 F347S probably damaging Het
Smim13 T A 13: 41,272,651 D54E probably benign Het
Snrnp200 T A 2: 127,228,016 I1027N probably damaging Het
Sult6b1 G T 17: 78,906,862 T6N probably damaging Het
Tas1r2 G A 4: 139,660,052 R245H probably benign Het
Tpo G A 12: 30,092,586 P713L probably damaging Het
Trank1 T C 9: 111,352,197 I429T probably damaging Het
Trip11 G A 12: 101,894,322 R254* probably null Het
Vmn2r65 A G 7: 84,946,483 V331A probably benign Het
Ypel3 T C 7: 126,778,093 S82P probably damaging Het
Zfp128 T C 7: 12,884,740 L55P probably damaging Het
Zscan4e T C 7: 11,307,510 D173G probably benign Het
Other mutations in Atg9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01464:Atg9a APN 1 75190366 missense probably damaging 1.00
IGL02041:Atg9a APN 1 75183104 missense possibly damaging 0.47
IGL03367:Atg9a APN 1 75187957 missense probably benign 0.18
PIT4494001:Atg9a UTSW 1 75187953 nonsense probably null
R0054:Atg9a UTSW 1 75184499 missense probably damaging 1.00
R0054:Atg9a UTSW 1 75184499 missense probably damaging 1.00
R0408:Atg9a UTSW 1 75185295 missense probably damaging 1.00
R0520:Atg9a UTSW 1 75186534 nonsense probably null
R0653:Atg9a UTSW 1 75190328 missense probably damaging 0.96
R0666:Atg9a UTSW 1 75185090 missense probably damaging 0.99
R0961:Atg9a UTSW 1 75186746 missense probably damaging 0.99
R1489:Atg9a UTSW 1 75186090 missense probably damaging 1.00
R1490:Atg9a UTSW 1 75185745 missense possibly damaging 0.70
R1692:Atg9a UTSW 1 75190355 missense probably benign 0.04
R1997:Atg9a UTSW 1 75189626 missense probably benign 0.33
R2005:Atg9a UTSW 1 75185991 missense probably benign 0.18
R2172:Atg9a UTSW 1 75185685 missense probably damaging 0.99
R4004:Atg9a UTSW 1 75186451 missense probably damaging 1.00
R5010:Atg9a UTSW 1 75186060 unclassified probably null
R5220:Atg9a UTSW 1 75185728 missense probably damaging 1.00
R5898:Atg9a UTSW 1 75186272 missense probably damaging 1.00
R6295:Atg9a UTSW 1 75185058 missense probably benign 0.01
R6390:Atg9a UTSW 1 75187981 missense probably damaging 1.00
R7312:Atg9a UTSW 1 75188092 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTATGATCTCCAGGGCC -3'
(R):5'- TGGCATTCTGGGAAAGGCTTC -3'

Sequencing Primer
(F):5'- TATGATCTCCAGGGCCCGAGG -3'
(R):5'- AAAGGCTTCTTTCTGTCTCACCATG -3'
Posted On2015-06-12