Incidental Mutation 'R4105:Atg9a'
ID 321327
Institutional Source Beutler Lab
Gene Symbol Atg9a
Ensembl Gene ENSMUSG00000033124
Gene Name autophagy related 9A
Synonyms Apg9l1
MMRRC Submission 040985-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4105 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 75157509-75168654 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 75162603 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 471 (Y471H)
Ref Sequence ENSEMBL: ENSMUSP00000139641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040689] [ENSMUST00000186744] [ENSMUST00000188347] [ENSMUST00000189702] [ENSMUST00000189665]
AlphaFold Q68FE2
Predicted Effect probably damaging
Transcript: ENSMUST00000040689
AA Change: Y471H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047449
Gene: ENSMUSG00000033124
AA Change: Y471H

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 173 530 3.4e-134 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185727
Predicted Effect probably benign
Transcript: ENSMUST00000186744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187601
Predicted Effect unknown
Transcript: ENSMUST00000187785
AA Change: Y30H
Predicted Effect probably damaging
Transcript: ENSMUST00000188347
AA Change: Y471H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139731
Gene: ENSMUSG00000033124
AA Change: Y471H

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 172 533 2.4e-140 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189702
AA Change: Y471H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139641
Gene: ENSMUSG00000033124
AA Change: Y471H

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 172 533 2.4e-140 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000189820
AA Change: Y463H
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188430
Predicted Effect probably benign
Transcript: ENSMUST00000189665
SMART Domains Protein: ENSMUSP00000140012
Gene: ENSMUSG00000033124

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Meta Mutation Damage Score 0.9154 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (46/48)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation all die within 1 day of birth and display impaired autophagy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adar T C 3: 89,647,401 (GRCm39) S127P probably benign Het
Arhgap31 A G 16: 38,422,788 (GRCm39) S1093P probably damaging Het
Asb18 T C 1: 89,896,243 (GRCm39) S266G possibly damaging Het
Atosa A G 9: 74,916,058 (GRCm39) Q226R probably damaging Het
Bmper G A 9: 23,136,059 (GRCm39) V47I probably benign Het
Cel T C 2: 28,448,039 (GRCm39) D329G probably benign Het
Ces2f T C 8: 105,677,824 (GRCm39) probably null Het
Cyp2j7 T C 4: 96,087,687 (GRCm39) T408A possibly damaging Het
Dchs1 A C 7: 105,414,347 (GRCm39) S823A probably damaging Het
Dnajb2 G T 1: 75,213,543 (GRCm39) E6* probably null Het
Eif2b3 G A 4: 116,938,831 (GRCm39) G427R probably damaging Het
Eml5 T C 12: 98,807,807 (GRCm39) probably null Het
Fat1 A G 8: 45,489,888 (GRCm39) Y3600C probably damaging Het
Fbxo10 A G 4: 45,059,054 (GRCm39) F228L probably benign Het
Fgf7 T A 2: 125,877,599 (GRCm39) probably benign Het
Gm2832 A T 14: 41,002,856 (GRCm39) M122L unknown Het
Lrrcc1 T C 3: 14,615,388 (GRCm39) V73A probably benign Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Naip5 T C 13: 100,356,247 (GRCm39) R1123G probably benign Het
Nfya G T 17: 48,699,912 (GRCm39) Y37* probably null Het
Or2o1 A G 11: 49,051,375 (GRCm39) H178R possibly damaging Het
Pikfyve A G 1: 65,229,679 (GRCm39) probably benign Het
Pnma8a T C 7: 16,695,104 (GRCm39) S320P possibly damaging Het
Polr1a A G 6: 71,953,175 (GRCm39) N1581S probably damaging Het
Polrmt G T 10: 79,577,567 (GRCm39) T344K probably benign Het
Postn T C 3: 54,283,462 (GRCm39) F514L probably damaging Het
Ptprq G T 10: 107,408,828 (GRCm39) T1895N probably damaging Het
Slc15a2 G T 16: 36,602,755 (GRCm39) probably benign Het
Slco2a1 T A 9: 102,945,075 (GRCm39) L150Q probably benign Het
Slco2a1 T C 9: 102,950,449 (GRCm39) F347S probably damaging Het
Smim13 T A 13: 41,426,127 (GRCm39) D54E probably benign Het
Snrnp200 T A 2: 127,069,936 (GRCm39) I1027N probably damaging Het
Sult6b1 G T 17: 79,214,291 (GRCm39) T6N probably damaging Het
Tas1r2 G A 4: 139,387,363 (GRCm39) R245H probably benign Het
Tpo G A 12: 30,142,585 (GRCm39) P713L probably damaging Het
Trank1 T C 9: 111,181,265 (GRCm39) I429T probably damaging Het
Trip11 G A 12: 101,860,581 (GRCm39) R254* probably null Het
Vmn2r65 A G 7: 84,595,691 (GRCm39) V331A probably benign Het
Ypel3 T C 7: 126,377,265 (GRCm39) S82P probably damaging Het
Zfp128 T C 7: 12,618,667 (GRCm39) L55P probably damaging Het
Zscan4e T C 7: 11,041,437 (GRCm39) D173G probably benign Het
Other mutations in Atg9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01464:Atg9a APN 1 75,167,010 (GRCm39) missense probably damaging 1.00
IGL02041:Atg9a APN 1 75,159,748 (GRCm39) missense possibly damaging 0.47
IGL03367:Atg9a APN 1 75,164,601 (GRCm39) missense probably benign 0.18
PIT4494001:Atg9a UTSW 1 75,164,597 (GRCm39) nonsense probably null
R0054:Atg9a UTSW 1 75,161,143 (GRCm39) missense probably damaging 1.00
R0054:Atg9a UTSW 1 75,161,143 (GRCm39) missense probably damaging 1.00
R0408:Atg9a UTSW 1 75,161,939 (GRCm39) missense probably damaging 1.00
R0520:Atg9a UTSW 1 75,163,178 (GRCm39) nonsense probably null
R0653:Atg9a UTSW 1 75,166,972 (GRCm39) missense probably damaging 0.96
R0666:Atg9a UTSW 1 75,161,734 (GRCm39) missense probably damaging 0.99
R0961:Atg9a UTSW 1 75,163,390 (GRCm39) missense probably damaging 0.99
R1489:Atg9a UTSW 1 75,162,734 (GRCm39) missense probably damaging 1.00
R1490:Atg9a UTSW 1 75,162,389 (GRCm39) missense possibly damaging 0.70
R1692:Atg9a UTSW 1 75,166,999 (GRCm39) missense probably benign 0.04
R1997:Atg9a UTSW 1 75,166,270 (GRCm39) missense probably benign 0.33
R2005:Atg9a UTSW 1 75,162,635 (GRCm39) missense probably benign 0.18
R2172:Atg9a UTSW 1 75,162,329 (GRCm39) missense probably damaging 0.99
R4004:Atg9a UTSW 1 75,163,095 (GRCm39) missense probably damaging 1.00
R5010:Atg9a UTSW 1 75,162,704 (GRCm39) splice site probably null
R5220:Atg9a UTSW 1 75,162,372 (GRCm39) missense probably damaging 1.00
R5898:Atg9a UTSW 1 75,162,916 (GRCm39) missense probably damaging 1.00
R6295:Atg9a UTSW 1 75,161,702 (GRCm39) missense probably benign 0.01
R6390:Atg9a UTSW 1 75,164,625 (GRCm39) missense probably damaging 1.00
R7312:Atg9a UTSW 1 75,164,736 (GRCm39) missense probably damaging 1.00
R7729:Atg9a UTSW 1 75,161,204 (GRCm39) missense probably benign 0.34
R8111:Atg9a UTSW 1 75,164,366 (GRCm39) missense probably damaging 1.00
R8210:Atg9a UTSW 1 75,163,009 (GRCm39) missense probably damaging 1.00
R8210:Atg9a UTSW 1 75,161,927 (GRCm39) missense probably damaging 1.00
R8256:Atg9a UTSW 1 75,163,563 (GRCm39) missense possibly damaging 0.88
R8319:Atg9a UTSW 1 75,162,342 (GRCm39) nonsense probably null
R8321:Atg9a UTSW 1 75,162,342 (GRCm39) nonsense probably null
R8382:Atg9a UTSW 1 75,162,342 (GRCm39) nonsense probably null
R8406:Atg9a UTSW 1 75,167,028 (GRCm39) missense probably damaging 1.00
R8482:Atg9a UTSW 1 75,162,870 (GRCm39) missense probably damaging 0.99
R8855:Atg9a UTSW 1 75,161,867 (GRCm39) missense probably damaging 1.00
R8866:Atg9a UTSW 1 75,161,867 (GRCm39) missense probably damaging 1.00
R9381:Atg9a UTSW 1 75,162,726 (GRCm39) missense probably benign
R9441:Atg9a UTSW 1 75,163,086 (GRCm39) missense possibly damaging 0.92
R9442:Atg9a UTSW 1 75,163,086 (GRCm39) missense possibly damaging 0.92
R9448:Atg9a UTSW 1 75,162,849 (GRCm39) missense probably benign 0.35
R9608:Atg9a UTSW 1 75,161,739 (GRCm39) missense possibly damaging 0.52
R9703:Atg9a UTSW 1 75,162,431 (GRCm39) missense probably damaging 0.98
RF021:Atg9a UTSW 1 75,159,273 (GRCm39) missense probably damaging 0.96
Z1176:Atg9a UTSW 1 75,163,203 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTATGATCTCCAGGGCC -3'
(R):5'- TGGCATTCTGGGAAAGGCTTC -3'

Sequencing Primer
(F):5'- TATGATCTCCAGGGCCCGAGG -3'
(R):5'- AAAGGCTTCTTTCTGTCTCACCATG -3'
Posted On 2015-06-12