Incidental Mutation 'R4105:Eif2b3'
ID321338
Institutional Source Beutler Lab
Gene Symbol Eif2b3
Ensembl Gene ENSMUSG00000028683
Gene Nameeukaryotic translation initiation factor 2B, subunit 3
Synonyms1190002P15Rik
MMRRC Submission 040985-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4105 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location117019402-117087306 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 117081634 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 427 (G427R)
Ref Sequence ENSEMBL: ENSMUSP00000102056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070610] [ENSMUST00000106448]
Predicted Effect probably benign
Transcript: ENSMUST00000070610
SMART Domains Protein: ENSMUSP00000070334
Gene: ENSMUSG00000028683

DomainStartEndE-ValueType
Pfam:NTP_transferase 4 139 8.2e-20 PFAM
Pfam:NTP_transf_3 5 226 8.5e-19 PFAM
low complexity region 247 262 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106448
AA Change: G427R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102056
Gene: ENSMUSG00000028683
AA Change: G427R

DomainStartEndE-ValueType
Pfam:NTP_transferase 4 140 3.2e-19 PFAM
Pfam:NTP_transf_3 5 237 3.7e-18 PFAM
low complexity region 247 262 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129587
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155181
Meta Mutation Damage Score 0.8260 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the subunits of initiation factor eIF2B, which catalyzes the exchange of eukaryotic initiation factor 2-bound GDP for GTP. It has also been found to function as a cofactor of hepatitis C virus internal ribosome entry site-mediated translation. Mutations in this gene have been associated with leukodystrophy with vanishing white matter. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adar T C 3: 89,740,094 S127P probably benign Het
Arhgap31 A G 16: 38,602,426 S1093P probably damaging Het
Asb18 T C 1: 89,968,521 S266G possibly damaging Het
Atg9a A G 1: 75,185,959 Y471H probably damaging Het
Bmper G A 9: 23,224,763 V47I probably benign Het
Cel T C 2: 28,558,027 D329G probably benign Het
Ces2f T C 8: 104,951,192 probably null Het
Cyp2j7 T C 4: 96,199,450 T408A possibly damaging Het
Dchs1 A C 7: 105,765,140 S823A probably damaging Het
Dnajb2 G T 1: 75,236,899 E6* probably null Het
Eml5 T C 12: 98,841,548 probably null Het
Fam214a A G 9: 75,008,776 Q226R probably damaging Het
Fat1 A G 8: 45,036,851 Y3600C probably damaging Het
Fbxo10 A G 4: 45,059,054 F228L probably benign Het
Fgf7 T A 2: 126,035,679 probably benign Het
Gm2832 A T 14: 41,280,899 M122L unknown Het
Lrrcc1 T C 3: 14,550,328 V73A probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Naip5 T C 13: 100,219,739 R1123G probably benign Het
Nfya G T 17: 48,392,884 Y37* probably null Het
Olfr1394 A G 11: 49,160,548 H178R possibly damaging Het
Pikfyve A G 1: 65,190,520 probably benign Het
Pnmal1 T C 7: 16,961,179 S320P possibly damaging Het
Polr1a A G 6: 71,976,191 N1581S probably damaging Het
Polrmt G T 10: 79,741,733 T344K probably benign Het
Postn T C 3: 54,376,041 F514L probably damaging Het
Ptprq G T 10: 107,572,967 T1895N probably damaging Het
Slc15a2 G T 16: 36,782,393 probably benign Het
Slco2a1 T A 9: 103,067,876 L150Q probably benign Het
Slco2a1 T C 9: 103,073,250 F347S probably damaging Het
Smim13 T A 13: 41,272,651 D54E probably benign Het
Snrnp200 T A 2: 127,228,016 I1027N probably damaging Het
Sult6b1 G T 17: 78,906,862 T6N probably damaging Het
Tas1r2 G A 4: 139,660,052 R245H probably benign Het
Tpo G A 12: 30,092,586 P713L probably damaging Het
Trank1 T C 9: 111,352,197 I429T probably damaging Het
Trip11 G A 12: 101,894,322 R254* probably null Het
Vmn2r65 A G 7: 84,946,483 V331A probably benign Het
Ypel3 T C 7: 126,778,093 S82P probably damaging Het
Zfp128 T C 7: 12,884,740 L55P probably damaging Het
Zscan4e T C 7: 11,307,510 D173G probably benign Het
Other mutations in Eif2b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Eif2b3 APN 4 117066469 missense probably benign
IGL01333:Eif2b3 APN 4 117070690 missense probably benign 0.31
IGL01564:Eif2b3 APN 4 117028542 missense probably benign 0.00
IGL01721:Eif2b3 APN 4 117058804 missense probably damaging 1.00
IGL02061:Eif2b3 APN 4 117028411 missense possibly damaging 0.78
R0835:Eif2b3 UTSW 4 117058805 missense probably damaging 1.00
R0924:Eif2b3 UTSW 4 117081578 missense possibly damaging 0.93
R2167:Eif2b3 UTSW 4 117028540 missense probably damaging 1.00
R2424:Eif2b3 UTSW 4 117070848 missense probably benign 0.01
R3902:Eif2b3 UTSW 4 117022207 missense probably damaging 1.00
R4688:Eif2b3 UTSW 4 117058849 missense probably benign 0.03
R4998:Eif2b3 UTSW 4 117066392 missense probably benign 0.06
R5033:Eif2b3 UTSW 4 117052736 missense probably damaging 1.00
R5123:Eif2b3 UTSW 4 117022211 missense probably damaging 1.00
R5493:Eif2b3 UTSW 4 117086722 missense possibly damaging 0.92
R5787:Eif2b3 UTSW 4 117044440 missense probably damaging 1.00
R5789:Eif2b3 UTSW 4 117028495 missense probably damaging 1.00
R6347:Eif2b3 UTSW 4 117044566 missense probably benign 0.05
R6361:Eif2b3 UTSW 4 117028425 missense possibly damaging 0.66
R6643:Eif2b3 UTSW 4 117070757 missense probably damaging 0.97
R6798:Eif2b3 UTSW 4 117066458 missense probably benign 0.00
R7299:Eif2b3 UTSW 4 117052822 missense probably benign 0.27
R7301:Eif2b3 UTSW 4 117052822 missense probably benign 0.27
R7451:Eif2b3 UTSW 4 117052796 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCCACTCTGTCCTCCAATAATAAC -3'
(R):5'- TATCAGCTGCTCTCCAGAGATG -3'

Sequencing Primer
(F):5'- GTCATGTACATGTAGCCACCAGTAG -3'
(R):5'- TGCTCTCCAGAGATGACCATAGG -3'
Posted On2015-06-12