Incidental Mutation 'R0398:Ttc21a'
ID32134
Institutional Source Beutler Lab
Gene Symbol Ttc21a
Ensembl Gene ENSMUSG00000032514
Gene Nametetratricopeptide repeat domain 21A
SynonymsThm2, 4921538N17Rik
MMRRC Submission 038603-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R0398 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location119937606-119967793 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119954562 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 570 (I570N)
Ref Sequence ENSEMBL: ENSMUSP00000035100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035100] [ENSMUST00000177637]
Predicted Effect probably damaging
Transcript: ENSMUST00000035100
AA Change: I570N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035100
Gene: ENSMUSG00000032514
AA Change: I570N

DomainStartEndE-ValueType
low complexity region 107 118 N/A INTRINSIC
Blast:TPR 214 247 6e-11 BLAST
TPR 326 359 4.55e1 SMART
TPR 494 527 1.97e1 SMART
Blast:TPR 528 561 1e-14 BLAST
TPR 565 598 2.63e1 SMART
Blast:TPR 617 649 6e-11 BLAST
TPR 721 754 1.33e0 SMART
TPR 755 788 4.84e-3 SMART
TPR 790 821 1.14e1 SMART
TPR 883 916 9.03e-3 SMART
low complexity region 921 935 N/A INTRINSIC
TPR 951 984 1.08e1 SMART
Blast:TPR 1022 1054 3e-12 BLAST
low complexity region 1117 1129 N/A INTRINSIC
TPR 1195 1228 2.22e-2 SMART
TPR 1264 1297 9.73e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160790
Predicted Effect probably benign
Transcript: ENSMUST00000177637
SMART Domains Protein: ENSMUSP00000136413
Gene: ENSMUSG00000052336

DomainStartEndE-ValueType
Pfam:7tm_1 49 294 3.5e-50 PFAM
Meta Mutation Damage Score 0.7208 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 93.8%
  • 20x: 83.2%
Validation Efficiency 100% (81/81)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A G 5: 9,445,367 R724G probably benign Het
Abcb11 T C 2: 69,286,666 Q546R probably null Het
Acr T G 15: 89,573,941 V275G probably damaging Het
Adam5 A G 8: 24,813,432 Y160H probably benign Het
Adcy5 T A 16: 35,269,068 M545K probably damaging Het
Aoc2 A G 11: 101,325,553 E154G possibly damaging Het
Atg2a T G 19: 6,246,578 L338R probably damaging Het
Atp2a1 T C 7: 126,450,418 probably benign Het
Bbs7 A G 3: 36,590,717 S436P probably benign Het
Bpnt1 T C 1: 185,338,158 Y16H probably benign Het
Cbll1 A T 12: 31,492,092 F90Y probably damaging Het
Cbs G T 17: 31,617,242 Q411K probably benign Het
Cdca2 A C 14: 67,697,962 F435V probably damaging Het
Cdh13 T G 8: 119,314,047 S664A probably damaging Het
Cdk17 T A 10: 93,237,840 V438E probably benign Het
Cep295 T C 9: 15,354,736 D40G possibly damaging Het
Col6a1 T C 10: 76,710,118 H840R unknown Het
Cpa1 A G 6: 30,645,251 T409A probably benign Het
Crlf1 G A 8: 70,499,089 probably benign Het
E2f2 T A 4: 136,180,544 I184N probably damaging Het
Ehbp1 T C 11: 22,095,886 D596G probably damaging Het
Ets2 A G 16: 95,716,223 Y333C probably damaging Het
Fam178b A G 1: 36,632,406 probably benign Het
Fndc3b A G 3: 27,461,779 V626A probably benign Het
Gart G T 16: 91,639,449 A140E probably damaging Het
Gbp7 T C 3: 142,545,513 S477P possibly damaging Het
Gm16380 T C 9: 53,884,169 noncoding transcript Het
Hmcn1 C A 1: 150,798,814 R579M possibly damaging Het
Hoxb8 A C 11: 96,283,111 H50P probably damaging Het
Hspa4 C T 11: 53,272,879 probably null Het
Hspa4l G A 3: 40,756,997 probably benign Het
Hyal4 A T 6: 24,756,671 Y296F probably damaging Het
Igsf8 C A 1: 172,317,499 T131K probably damaging Het
Ilvbl C T 10: 78,579,539 P298L probably damaging Het
Jak2 T A 19: 29,282,388 I229N possibly damaging Het
Kif1b T C 4: 149,204,231 D1205G possibly damaging Het
Lrrc63 T C 14: 75,126,470 R74G probably benign Het
Lvrn A G 18: 46,880,693 T481A probably benign Het
Macf1 T A 4: 123,351,017 T7312S probably damaging Het
Magel2 C T 7: 62,380,551 Q1068* probably null Het
Mrpl3 A G 9: 105,064,103 Y203C probably damaging Het
Nek2 T A 1: 191,827,361 I326N probably benign Het
Nlrc4 A C 17: 74,445,920 N489K probably damaging Het
Nlrp4f A T 13: 65,194,918 S304R possibly damaging Het
Ogfr C G 2: 180,593,699 R189G probably damaging Het
Olfr1151 A T 2: 87,858,057 N294I probably damaging Het
Olfr506 T A 7: 108,612,955 I216N probably benign Het
Olfr548-ps1 T A 7: 102,542,692 L252H probably damaging Het
Orm3 A G 4: 63,357,648 S145G probably benign Het
Pclo A G 5: 14,681,702 E3406G unknown Het
Pcx T G 19: 4,601,610 F4C probably benign Het
Pgd C A 4: 149,153,882 G364V probably damaging Het
Pla2g12a C A 3: 129,890,396 D102E probably benign Het
Pnpo A T 11: 96,942,427 C82* probably null Het
Prdm1 T C 10: 44,439,809 N792S probably damaging Het
Prim2 A T 1: 33,484,676 probably benign Het
Proca1 C A 11: 78,205,268 P242Q probably benign Het
Psmc5 A G 11: 106,261,544 N129S probably benign Het
Ptchd4 A G 17: 42,377,259 T231A possibly damaging Het
Qrfpr C T 3: 36,181,052 probably benign Het
Rab44 G A 17: 29,145,370 probably benign Het
Racgap1 T C 15: 99,628,627 probably benign Het
Rapgef4 A G 2: 72,031,041 E25G probably damaging Het
Rpl8 G C 15: 76,905,046 probably benign Het
Samd12 G A 15: 53,719,720 P73S possibly damaging Het
Samd9l T A 6: 3,374,502 N920Y probably damaging Het
Sdk1 T C 5: 141,962,721 V607A probably benign Het
Slc25a19 A G 11: 115,617,575 Y196H probably damaging Het
Slc39a3 A T 10: 81,033,787 M12K possibly damaging Het
Slc5a4a T C 10: 76,182,722 I501T possibly damaging Het
Sp4 A T 12: 118,298,673 V546D possibly damaging Het
Ssh3 C T 19: 4,263,699 V511M possibly damaging Het
Stard9 T G 2: 120,696,307 V1015G probably benign Het
Thoc5 G T 11: 4,921,978 V516F possibly damaging Het
Ttc4 T C 4: 106,667,573 probably null Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Yipf3 A G 17: 46,251,485 E298G possibly damaging Het
Zbtb34 C A 2: 33,411,048 E494* probably null Het
Zfhx3 A G 8: 108,951,246 Y2976C probably damaging Het
Other mutations in Ttc21a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Ttc21a APN 9 119965819 missense probably damaging 0.96
IGL01996:Ttc21a APN 9 119958116 missense probably damaging 0.99
IGL02160:Ttc21a APN 9 119956923 missense probably damaging 1.00
IGL02163:Ttc21a APN 9 119950835 nonsense probably null
IGL02252:Ttc21a APN 9 119956928 missense probably damaging 1.00
IGL02901:Ttc21a APN 9 119958281 missense probably damaging 0.98
IGL03105:Ttc21a APN 9 119942576 missense probably benign 0.01
IGL03155:Ttc21a APN 9 119943976 critical splice donor site probably null
IGL03323:Ttc21a APN 9 119940536 intron probably benign
R0054:Ttc21a UTSW 9 119943940 missense probably damaging 1.00
R0452:Ttc21a UTSW 9 119939154 intron probably benign
R0541:Ttc21a UTSW 9 119956826 intron probably benign
R0545:Ttc21a UTSW 9 119958799 missense probably damaging 0.99
R0605:Ttc21a UTSW 9 119961842 missense possibly damaging 0.93
R1352:Ttc21a UTSW 9 119954652 missense possibly damaging 0.49
R1417:Ttc21a UTSW 9 119954261 missense probably damaging 0.99
R1471:Ttc21a UTSW 9 119942641 missense probably damaging 1.00
R1479:Ttc21a UTSW 9 119956947 missense probably benign 0.00
R1631:Ttc21a UTSW 9 119954162 intron probably null
R1905:Ttc21a UTSW 9 119966757 missense possibly damaging 0.82
R2141:Ttc21a UTSW 9 119964295 missense probably damaging 0.98
R2213:Ttc21a UTSW 9 119940461 missense probably benign 0.01
R2265:Ttc21a UTSW 9 119959008 missense possibly damaging 0.62
R2327:Ttc21a UTSW 9 119966123 missense probably damaging 1.00
R2656:Ttc21a UTSW 9 119941265 missense probably damaging 0.98
R3000:Ttc21a UTSW 9 119952254 missense probably benign 0.02
R3792:Ttc21a UTSW 9 119954165 missense probably damaging 1.00
R3938:Ttc21a UTSW 9 119950816 intron probably benign
R4232:Ttc21a UTSW 9 119942618 missense probably benign 0.00
R4492:Ttc21a UTSW 9 119941280 missense probably benign 0.00
R4498:Ttc21a UTSW 9 119958819 missense possibly damaging 0.82
R4655:Ttc21a UTSW 9 119961762 missense possibly damaging 0.80
R4890:Ttc21a UTSW 9 119959037 missense probably benign
R4960:Ttc21a UTSW 9 119945001 missense possibly damaging 0.51
R4972:Ttc21a UTSW 9 119944961 missense probably benign 0.00
R5015:Ttc21a UTSW 9 119966129 missense probably damaging 0.98
R5092:Ttc21a UTSW 9 119942665 missense probably benign 0.01
R5117:Ttc21a UTSW 9 119966565 missense possibly damaging 0.64
R5123:Ttc21a UTSW 9 119952212 missense probably benign 0.04
R5452:Ttc21a UTSW 9 119950971 missense probably benign 0.00
R5733:Ttc21a UTSW 9 119941261 missense probably benign
R5734:Ttc21a UTSW 9 119966666 missense probably benign
R5869:Ttc21a UTSW 9 119958792 missense probably benign 0.03
R6214:Ttc21a UTSW 9 119966772 missense probably damaging 1.00
R6215:Ttc21a UTSW 9 119966772 missense probably damaging 1.00
R6279:Ttc21a UTSW 9 119961839 missense possibly damaging 0.78
R6284:Ttc21a UTSW 9 119943962 missense probably damaging 1.00
R6300:Ttc21a UTSW 9 119961839 missense possibly damaging 0.78
R6800:Ttc21a UTSW 9 119941202 missense possibly damaging 0.61
R6833:Ttc21a UTSW 9 119942635 missense probably benign 0.24
R7009:Ttc21a UTSW 9 119958073 nonsense probably null
R7060:Ttc21a UTSW 9 119966676 missense probably damaging 0.98
R7170:Ttc21a UTSW 9 119945541 missense probably damaging 0.99
R7418:Ttc21a UTSW 9 119959051 missense probably benign 0.01
R7438:Ttc21a UTSW 9 119945539 missense probably damaging 1.00
R7595:Ttc21a UTSW 9 119958069 missense probably benign 0.12
R7703:Ttc21a UTSW 9 119959029 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TCCTGAAGATCCCTGGACACAGAC -3'
(R):5'- ACTAGCTCTAGCAGGATGGATGCC -3'

Sequencing Primer
(F):5'- TGGGTGTCAGCCACAACTTC -3'
(R):5'- AGGATGGATGCCCGCTC -3'
Posted On2013-04-24