Incidental Mutation 'R4105:Tas1r2'
ID321340
Institutional Source Beutler Lab
Gene Symbol Tas1r2
Ensembl Gene ENSMUSG00000028738
Gene Nametaste receptor, type 1, member 2
SynonymsGpr71, TR2, T1r2
MMRRC Submission 040985-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R4105 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location139653538-139670280 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 139660052 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 245 (R245H)
Ref Sequence ENSEMBL: ENSMUSP00000127737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030510] [ENSMUST00000166773] [ENSMUST00000178644]
Predicted Effect probably benign
Transcript: ENSMUST00000030510
AA Change: R274H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000030510
Gene: ENSMUSG00000028738
AA Change: R274H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 73 459 2e-90 PFAM
Pfam:NCD3G 495 548 2.4e-17 PFAM
Pfam:7tm_3 581 818 2.8e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166773
AA Change: R245H

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000127737
Gene: ENSMUSG00000028738
AA Change: R245H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 73 213 5.3e-38 PFAM
Pfam:ANF_receptor 217 429 8.4e-31 PFAM
Pfam:NCD3G 466 519 7.4e-19 PFAM
Pfam:7tm_3 550 790 3e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178644
SMART Domains Protein: ENSMUSP00000136776
Gene: ENSMUSG00000094439

DomainStartEndE-ValueType
SCOP:d1lbva_ 1 60 5e-3 SMART
Pfam:Filament 165 253 7.3e-13 PFAM
low complexity region 255 268 N/A INTRINSIC
Meta Mutation Damage Score 0.08 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (46/48)
MGI Phenotype PHENOTYPE: Homozygous mutant mice show diminished behavioral and nervous responses to sweet tastants. Response to umami tastants is unimpaired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adar T C 3: 89,740,094 S127P probably benign Het
Arhgap31 A G 16: 38,602,426 S1093P probably damaging Het
Asb18 T C 1: 89,968,521 S266G possibly damaging Het
Atg9a A G 1: 75,185,959 Y471H probably damaging Het
Bmper G A 9: 23,224,763 V47I probably benign Het
Cel T C 2: 28,558,027 D329G probably benign Het
Ces2f T C 8: 104,951,192 probably null Het
Cyp2j7 T C 4: 96,199,450 T408A possibly damaging Het
Dchs1 A C 7: 105,765,140 S823A probably damaging Het
Dnajb2 G T 1: 75,236,899 E6* probably null Het
Eif2b3 G A 4: 117,081,634 G427R probably damaging Het
Eml5 T C 12: 98,841,548 probably null Het
Fam214a A G 9: 75,008,776 Q226R probably damaging Het
Fat1 A G 8: 45,036,851 Y3600C probably damaging Het
Fbxo10 A G 4: 45,059,054 F228L probably benign Het
Fgf7 T A 2: 126,035,679 probably benign Het
Gm2832 A T 14: 41,280,899 M122L unknown Het
Lrrcc1 T C 3: 14,550,328 V73A probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Naip5 T C 13: 100,219,739 R1123G probably benign Het
Nfya G T 17: 48,392,884 Y37* probably null Het
Olfr1394 A G 11: 49,160,548 H178R possibly damaging Het
Pikfyve A G 1: 65,190,520 probably benign Het
Pnmal1 T C 7: 16,961,179 S320P possibly damaging Het
Polr1a A G 6: 71,976,191 N1581S probably damaging Het
Polrmt G T 10: 79,741,733 T344K probably benign Het
Postn T C 3: 54,376,041 F514L probably damaging Het
Ptprq G T 10: 107,572,967 T1895N probably damaging Het
Slc15a2 G T 16: 36,782,393 probably benign Het
Slco2a1 T A 9: 103,067,876 L150Q probably benign Het
Slco2a1 T C 9: 103,073,250 F347S probably damaging Het
Smim13 T A 13: 41,272,651 D54E probably benign Het
Snrnp200 T A 2: 127,228,016 I1027N probably damaging Het
Sult6b1 G T 17: 78,906,862 T6N probably damaging Het
Tpo G A 12: 30,092,586 P713L probably damaging Het
Trank1 T C 9: 111,352,197 I429T probably damaging Het
Trip11 G A 12: 101,894,322 R254* probably null Het
Vmn2r65 A G 7: 84,946,483 V331A probably benign Het
Ypel3 T C 7: 126,778,093 S82P probably damaging Het
Zfp128 T C 7: 12,884,740 L55P probably damaging Het
Zscan4e T C 7: 11,307,510 D173G probably benign Het
Other mutations in Tas1r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Tas1r2 APN 4 139660291 missense probably benign 0.03
IGL00952:Tas1r2 APN 4 139655252 missense probably benign 0.00
IGL00972:Tas1r2 APN 4 139660036 missense probably damaging 0.99
IGL01939:Tas1r2 APN 4 139669177 missense probably damaging 1.00
IGL02247:Tas1r2 APN 4 139669516 missense probably damaging 1.00
IGL02663:Tas1r2 APN 4 139660282 missense probably benign
IGL03155:Tas1r2 APN 4 139669156 missense possibly damaging 0.95
R0395:Tas1r2 UTSW 4 139655354 missense possibly damaging 0.86
R0798:Tas1r2 UTSW 4 139669713 missense probably damaging 1.00
R1221:Tas1r2 UTSW 4 139669125 missense probably benign 0.00
R1223:Tas1r2 UTSW 4 139660204 missense probably damaging 1.00
R1261:Tas1r2 UTSW 4 139655288 missense probably damaging 0.99
R1262:Tas1r2 UTSW 4 139655288 missense probably damaging 0.99
R1330:Tas1r2 UTSW 4 139669329 missense probably benign 0.05
R1466:Tas1r2 UTSW 4 139669411 missense probably damaging 1.00
R1466:Tas1r2 UTSW 4 139669411 missense probably damaging 1.00
R1879:Tas1r2 UTSW 4 139669695 missense probably damaging 1.00
R2112:Tas1r2 UTSW 4 139655355 missense probably benign 0.00
R2156:Tas1r2 UTSW 4 139669041 missense possibly damaging 0.79
R2509:Tas1r2 UTSW 4 139659851 missense probably damaging 1.00
R2510:Tas1r2 UTSW 4 139659851 missense probably damaging 1.00
R2511:Tas1r2 UTSW 4 139659851 missense probably damaging 1.00
R3429:Tas1r2 UTSW 4 139669575 missense probably damaging 1.00
R3430:Tas1r2 UTSW 4 139669575 missense probably damaging 1.00
R3703:Tas1r2 UTSW 4 139667418 missense probably damaging 1.00
R4106:Tas1r2 UTSW 4 139660052 missense probably benign 0.06
R4107:Tas1r2 UTSW 4 139660052 missense probably benign 0.06
R4614:Tas1r2 UTSW 4 139659787 missense probably damaging 1.00
R4811:Tas1r2 UTSW 4 139669000 missense probably damaging 1.00
R5314:Tas1r2 UTSW 4 139655361 missense probably damaging 1.00
R5461:Tas1r2 UTSW 4 139660009 missense probably benign 0.01
R5639:Tas1r2 UTSW 4 139659796 missense probably damaging 1.00
R5703:Tas1r2 UTSW 4 139667336 missense probably damaging 1.00
R6176:Tas1r2 UTSW 4 139668888 missense probably damaging 1.00
R6297:Tas1r2 UTSW 4 139662050 missense possibly damaging 0.47
R6441:Tas1r2 UTSW 4 139669156 missense probably damaging 0.99
R6748:Tas1r2 UTSW 4 139669611 missense probably damaging 0.98
R6863:Tas1r2 UTSW 4 139669719 missense probably damaging 1.00
R6975:Tas1r2 UTSW 4 139669720 missense probably damaging 1.00
R7106:Tas1r2 UTSW 4 139662049 missense probably benign
R7265:Tas1r2 UTSW 4 139669652 missense probably benign 0.01
Z1088:Tas1r2 UTSW 4 139660424 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGACGATTATGGCCGAGAGAAC -3'
(R):5'- ATACTCTGGCTTGTCGTGGC -3'

Sequencing Primer
(F):5'- TTATGGCCGAGAGAACAGCCAC -3'
(R):5'- ACTCGGAACTGGCTGAAGC -3'
Posted On2015-06-12