Mutagenetix > Incidental Mutations

Incidental Mutation 'R4105:Pnmal1'

321344

Institutional Source

Beutler Lab

Gene Symbol

Pnmal1

Ensembl Gene

ENSMUSG00000041141

Gene Name

PNMA-like 1

Synonyms

MMRRC Submission

040985-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.076) question?

Stock #

R4105 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

16959679-16964607 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 16961179 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 320 (S320P)

Ref Sequence

ENSEMBL: ENSMUSP00000040929 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038163]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000038163
AA Change: S320P

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000040929
Gene: ENSMUSG00000041141
AA Change: S320P

Domain	Start	End	E-Value	Type
Pfam:PNMA	5	364	6.9e-108	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

96% (46/48)

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adar	T	C	3: 89,740,094	S127P	probably benign	Het
Arhgap31	A	G	16: 38,602,426	S1093P	probably damaging	Het
Asb18	T	C	1: 89,968,521	S266G	possibly damaging	Het
Atg9a	A	G	1: 75,185,959	Y471H	probably damaging	Het
Bmper	G	A	9: 23,224,763	V47I	probably benign	Het
Cel	T	C	2: 28,558,027	D329G	probably benign	Het
Ces2f	T	C	8: 104,951,192		probably null	Het
Cyp2j7	T	C	4: 96,199,450	T408A	possibly damaging	Het
Dchs1	A	C	7: 105,765,140	S823A	probably damaging	Het
Dnajb2	G	T	1: 75,236,899	E6*	probably null	Het
Eif2b3	G	A	4: 117,081,634	G427R	probably damaging	Het
Eml5	T	C	12: 98,841,548		probably null	Het
Fam214a	A	G	9: 75,008,776	Q226R	probably damaging	Het
Fat1	A	G	8: 45,036,851	Y3600C	probably damaging	Het
Fbxo10	A	G	4: 45,059,054	F228L	probably benign	Het
Fgf7	T	A	2: 126,035,679		probably benign	Het
Gm2832	A	T	14: 41,280,899	M122L	unknown	Het
Lrrcc1	T	C	3: 14,550,328	V73A	probably benign	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Naip5	T	C	13: 100,219,739	R1123G	probably benign	Het
Nfya	G	T	17: 48,392,884	Y37*	probably null	Het
Olfr1394	A	G	11: 49,160,548	H178R	possibly damaging	Het
Pikfyve	A	G	1: 65,190,520		probably benign	Het
Polr1a	A	G	6: 71,976,191	N1581S	probably damaging	Het
Polrmt	G	T	10: 79,741,733	T344K	probably benign	Het
Postn	T	C	3: 54,376,041	F514L	probably damaging	Het
Ptprq	G	T	10: 107,572,967	T1895N	probably damaging	Het
Slc15a2	G	T	16: 36,782,393		probably benign	Het
Slco2a1	T	A	9: 103,067,876	L150Q	probably benign	Het
Slco2a1	T	C	9: 103,073,250	F347S	probably damaging	Het
Smim13	T	A	13: 41,272,651	D54E	probably benign	Het
Snrnp200	T	A	2: 127,228,016	I1027N	probably damaging	Het
Sult6b1	G	T	17: 78,906,862	T6N	probably damaging	Het
Tas1r2	G	A	4: 139,660,052	R245H	probably benign	Het
Tpo	G	A	12: 30,092,586	P713L	probably damaging	Het
Trank1	T	C	9: 111,352,197	I429T	probably damaging	Het
Trip11	G	A	12: 101,894,322	R254*	probably null	Het
Vmn2r65	A	G	7: 84,946,483	V331A	probably benign	Het
Ypel3	T	C	7: 126,778,093	S82P	probably damaging	Het
Zfp128	T	C	7: 12,884,740	L55P	probably damaging	Het
Zscan4e	T	C	7: 11,307,510	D173G	probably benign	Het

Other mutations in Pnmal1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
FR4737:Pnmal1	UTSW	7	16961425	small insertion	probably benign
R0116:Pnmal1	UTSW	7	16960700	missense	probably damaging	0.97
R0140:Pnmal1	UTSW	7	16960222	start codon destroyed	probably null	0.00
R1109:Pnmal1	UTSW	7	16961467	nonsense	probably null
R1306:Pnmal1	UTSW	7	16962025	missense	probably benign	0.00
R1426:Pnmal1	UTSW	7	16960984	missense	possibly damaging	0.56
R2000:Pnmal1	UTSW	7	16961039	missense	probably benign	0.01
R2404:Pnmal1	UTSW	7	16960391	missense	probably damaging	1.00
R3415:Pnmal1	UTSW	7	16960954	missense	possibly damaging	0.74
R3708:Pnmal1	UTSW	7	16960225	missense	probably damaging	1.00
R4009:Pnmal1	UTSW	7	16961376	missense	probably damaging	1.00
R5126:Pnmal1	UTSW	7	16961317	missense	probably benign	0.03
R5244:Pnmal1	UTSW	7	16961323	missense	probably damaging	0.99
R5825:Pnmal1	UTSW	7	16961095	missense	probably benign	0.01
R5931:Pnmal1	UTSW	7	16960884	missense	probably benign	0.31
R6128:Pnmal1	UTSW	7	16960736	missense	probably benign	0.00
R7337:Pnmal1	UTSW	7	16961390	missense	probably benign	0.35
R7756:Pnmal1	UTSW	7	16961299	missense	probably benign	0.27
R7758:Pnmal1	UTSW	7	16961299	missense	probably benign	0.27
RF007:Pnmal1	UTSW	7	16961424	small insertion	probably benign
RF009:Pnmal1	UTSW	7	16961427	small insertion	probably benign
RF020:Pnmal1	UTSW	7	16961451	small insertion	probably benign
RF022:Pnmal1	UTSW	7	16961427	small insertion	probably benign
RF029:Pnmal1	UTSW	7	16961444	nonsense	probably null
RF039:Pnmal1	UTSW	7	16961444	small insertion	probably benign
RF041:Pnmal1	UTSW	7	16961444	nonsense	probably null
RF046:Pnmal1	UTSW	7	16961423	small insertion	probably benign
RF047:Pnmal1	UTSW	7	16961423	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- AGGGCAGCAATTACAACAGC -3'
(R):5'- GCACCAAGCCCTTTCTTCAG -3'

Sequencing Primer
(F):5'- GGGCAGCAATTACAACAGCAATTAC -3'
(R):5'- TGGCTTCAGCATCAAGCAG -3'

Posted On

2015-06-12