Incidental Mutation 'R4105:Slco2a1'
ID321355
Institutional Source Beutler Lab
Gene Symbol Slco2a1
Ensembl Gene ENSMUSG00000032548
Gene Namesolute carrier organic anion transporter family, member 2a1
SynonymsPgt, mPgt, 2310021C19Rik, Slc21a2
MMRRC Submission 040985-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4105 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location102988712-103096002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103073250 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 347 (F347S)
Ref Sequence ENSEMBL: ENSMUSP00000140533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035148] [ENSMUST00000188664]
Predicted Effect probably damaging
Transcript: ENSMUST00000035148
AA Change: F347S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035148
Gene: ENSMUSG00000032548
AA Change: F347S

DomainStartEndE-ValueType
Pfam:MFS_1 39 428 3.5e-22 PFAM
KAZAL 446 493 2.78e-2 SMART
transmembrane domain 605 627 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188664
AA Change: F347S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140533
Gene: ENSMUSG00000032548
AA Change: F347S

DomainStartEndE-ValueType
Pfam:OATP 31 381 4.8e-135 PFAM
Pfam:MFS_1 39 413 1.8e-19 PFAM
Meta Mutation Damage Score 0.526 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a prostaglandin transporter that is a member of the 12-membrane-spanning superfamily of transporters. The encoded protein may be involved in mediating the uptake and clearance of prostaglandins in numerous tissues. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preinatel or early psotnatal lethality due to a patent ductus arteriosus and abnormal protaglandin metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adar T C 3: 89,740,094 S127P probably benign Het
Arhgap31 A G 16: 38,602,426 S1093P probably damaging Het
Asb18 T C 1: 89,968,521 S266G possibly damaging Het
Atg9a A G 1: 75,185,959 Y471H probably damaging Het
Bmper G A 9: 23,224,763 V47I probably benign Het
Cel T C 2: 28,558,027 D329G probably benign Het
Ces2f T C 8: 104,951,192 probably null Het
Cyp2j7 T C 4: 96,199,450 T408A possibly damaging Het
Dchs1 A C 7: 105,765,140 S823A probably damaging Het
Dnajb2 G T 1: 75,236,899 E6* probably null Het
Eif2b3 G A 4: 117,081,634 G427R probably damaging Het
Eml5 T C 12: 98,841,548 probably null Het
Fam214a A G 9: 75,008,776 Q226R probably damaging Het
Fat1 A G 8: 45,036,851 Y3600C probably damaging Het
Fbxo10 A G 4: 45,059,054 F228L probably benign Het
Fgf7 T A 2: 126,035,679 probably benign Het
Gm2832 A T 14: 41,280,899 M122L unknown Het
Lrrcc1 T C 3: 14,550,328 V73A probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Naip5 T C 13: 100,219,739 R1123G probably benign Het
Nfya G T 17: 48,392,884 Y37* probably null Het
Olfr1394 A G 11: 49,160,548 H178R possibly damaging Het
Pikfyve A G 1: 65,190,520 probably benign Het
Pnmal1 T C 7: 16,961,179 S320P possibly damaging Het
Polr1a A G 6: 71,976,191 N1581S probably damaging Het
Polrmt G T 10: 79,741,733 T344K probably benign Het
Postn T C 3: 54,376,041 F514L probably damaging Het
Ptprq G T 10: 107,572,967 T1895N probably damaging Het
Slc15a2 G T 16: 36,782,393 probably benign Het
Smim13 T A 13: 41,272,651 D54E probably benign Het
Snrnp200 T A 2: 127,228,016 I1027N probably damaging Het
Sult6b1 G T 17: 78,906,862 T6N probably damaging Het
Tas1r2 G A 4: 139,660,052 R245H probably benign Het
Tpo G A 12: 30,092,586 P713L probably damaging Het
Trank1 T C 9: 111,352,197 I429T probably damaging Het
Trip11 G A 12: 101,894,322 R254* probably null Het
Vmn2r65 A G 7: 84,946,483 V331A probably benign Het
Ypel3 T C 7: 126,778,093 S82P probably damaging Het
Zfp128 T C 7: 12,884,740 L55P probably damaging Het
Zscan4e T C 7: 11,307,510 D173G probably benign Het
Other mutations in Slco2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Slco2a1 APN 9 103079441 splice site probably benign
IGL01481:Slco2a1 APN 9 103070251 missense probably damaging 1.00
IGL01647:Slco2a1 APN 9 103070296 missense possibly damaging 0.57
IGL01885:Slco2a1 APN 9 103074430 missense probably damaging 1.00
IGL02150:Slco2a1 APN 9 103084818 missense probably damaging 1.00
IGL02508:Slco2a1 APN 9 103074416 missense probably benign
IGL02578:Slco2a1 APN 9 103046758 missense probably damaging 1.00
IGL02622:Slco2a1 APN 9 103076929 nonsense probably null
IGL02898:Slco2a1 APN 9 103079606 missense probably damaging 1.00
IGL03101:Slco2a1 APN 9 103077006 missense possibly damaging 0.69
PIT4431001:Slco2a1 UTSW 9 103050268 missense probably damaging 1.00
R0410:Slco2a1 UTSW 9 103073314 critical splice donor site probably null
R0831:Slco2a1 UTSW 9 103082334 missense probably damaging 0.99
R0885:Slco2a1 UTSW 9 103082383 missense probably damaging 0.98
R1975:Slco2a1 UTSW 9 103079454 nonsense probably null
R2095:Slco2a1 UTSW 9 103076968 missense probably benign 0.22
R4072:Slco2a1 UTSW 9 103068002 missense probably damaging 1.00
R4105:Slco2a1 UTSW 9 103067876 missense probably benign 0.01
R4804:Slco2a1 UTSW 9 103073184 missense probably damaging 1.00
R4881:Slco2a1 UTSW 9 103085832 missense possibly damaging 0.71
R5073:Slco2a1 UTSW 9 103046726 missense probably damaging 1.00
R5124:Slco2a1 UTSW 9 103050166 missense probably damaging 1.00
R5147:Slco2a1 UTSW 9 103050269 missense probably damaging 1.00
R5317:Slco2a1 UTSW 9 103079579 missense probably benign 0.01
R5363:Slco2a1 UTSW 9 103070263 missense probably damaging 0.99
R5381:Slco2a1 UTSW 9 103068014 missense probably damaging 1.00
R5732:Slco2a1 UTSW 9 103050256 missense probably damaging 1.00
R5736:Slco2a1 UTSW 9 103067830 missense probably benign 0.00
R5924:Slco2a1 UTSW 9 103046699 nonsense probably null
R5945:Slco2a1 UTSW 9 103046790 missense probably damaging 1.00
R6293:Slco2a1 UTSW 9 103050147 missense probably benign 0.30
R6386:Slco2a1 UTSW 9 103076988 missense probably benign
R6622:Slco2a1 UTSW 9 103074505 missense possibly damaging 0.84
R7484:Slco2a1 UTSW 9 103067986 missense probably damaging 1.00
Z1088:Slco2a1 UTSW 9 103079527 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AAGCTGTCCTTGTGGATGAG -3'
(R):5'- TAAAATTCTTTCTCTCCGGCAAGC -3'

Sequencing Primer
(F):5'- CCTTGTGGATGAGTCAGGGTGAC -3'
(R):5'- GGCAAGCCCTCCTGTCTC -3'
Posted On2015-06-12