Mutagenetix > Incidental Mutation

Incidental Mutation 'R4106:Slc19a3'

321373

Institutional Source

Beutler Lab

Gene Symbol

Slc19a3

Ensembl Gene

ENSMUSG00000038496

Gene Name

solute carrier family 19, member 3

Synonyms

ThTr2, A230084E24Rik

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.109) question?

Stock #

R4106 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

83012523-83038448 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 83022957 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Tyrosine at position 113 (F113Y)

Ref Sequence

ENSEMBL: ENSMUSP00000126646 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045560] [ENSMUST00000164473]

AlphaFold

Q99PL8

Predicted Effect

probably damaging
Transcript: ENSMUST00000045560
AA Change: F113Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000041683
Gene: ENSMUSG00000038496
AA Change: F113Y

Domain	Start	End	E-Value	Type
Pfam:Folate_carrier	11	435	1.4e-178	PFAM
Pfam:MFS_1	16	416	1.6e-17	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142805

Predicted Effect

probably damaging
Transcript: ENSMUST00000164473
AA Change: F113Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000126646
Gene: ENSMUSG00000038496
AA Change: F113Y

Domain	Start	End	E-Value	Type
Pfam:Folate_carrier	11	435	1.3e-178	PFAM
Pfam:MFS_1	16	416	1.9e-17	PFAM

Meta Mutation Damage Score

0.4327

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed transmembrane thiamine transporter that lacks folate transport activity. Mutations in this gene cause biotin-responsive basal ganglia disease (BBGD); a recessive disorder manifested in childhood that progresses to chronic encephalopathy, dystonia, quadriparesis, and death if untreated. Patients with BBGD have bilateral necrosis in the head of the caudate nucleus and in the putamen. Administration of high doses of biotin in the early progression of the disorder eliminates pathological symptoms while delayed treatment results in residual paraparesis, mild mental retardation, or dystonia. Administration of thiamine is ineffective in the treatment of this disorder. Experiments have failed to show that this protein can transport biotin. Mutations in this gene also cause a Wernicke's-like encephalopathy.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death within a year of age, impaired thiamin uptake, lethargy, cachexia, injured liver parenchyma, hepatic necrosis, liver and kidney inflammmation, and nephrosclerosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad10	G	T	5: 121,631,464	S643Y	probably damaging	Het
Acox3	T	C	5: 35,601,552	F369S	probably damaging	Het
Cacna1a	A	G	8: 84,583,695	I1461V	possibly damaging	Het
Cdc42bpb	A	C	12: 111,295,145	V107G	probably benign	Het
Cdhr4	A	G	9: 107,996,260	D397G	probably damaging	Het
Chd1l	T	C	3: 97,597,703	T183A	probably benign	Het
Cnbd2	T	C	2: 156,335,398	V92A	probably damaging	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Cyp2j7	T	C	4: 96,199,450	T408A	possibly damaging	Het
H2-T24	A	G	17: 36,017,478	S38P	possibly damaging	Het
Mapkapk3	A	G	9: 107,257,066	V333A	probably damaging	Het
Muc5ac	T	G	7: 141,802,835	V1053G	possibly damaging	Het
Myh1	T	C	11: 67,211,577	V898A	probably benign	Het
Nnt	T	C	13: 119,396,791	I113V	probably benign	Het
Obscn	T	C	11: 59,131,646	R758G	possibly damaging	Het
Olfr1166	A	T	2: 88,124,473	C171S	possibly damaging	Het
Rpl10a	T	A	17: 28,330,959	Y205N	probably benign	Het
Ryr3	C	G	2: 112,675,873	R3443P	probably damaging	Het
Scn3a	A	G	2: 65,495,035	I1046T	probably benign	Het
Sertad4	AGAGGAGGAGGAGGAGGAGGAGGA	AGAGGAGGAGGAGGAGGAGGA	1: 192,846,742		probably benign	Het
Sipa1l2	T	C	8: 125,492,308	K97E	probably damaging	Het
Slc22a6	A	G	19: 8,618,510	Q72R	probably benign	Het
St8sia2	A	C	7: 73,960,761	L258R	probably damaging	Het
Tas1r2	G	A	4: 139,660,052	R245H	probably benign	Het
Tcerg1l	A	G	7: 138,259,944	V352A	probably damaging	Het
Tpo	G	A	12: 30,092,586	P713L	probably damaging	Het
Tpp2	T	C	1: 44,001,457	Y293H	possibly damaging	Het
Ttn	G	C	2: 76,750,871	A23226G	probably damaging	Het
Ttn	C	T	2: 76,778,465	V15990I	probably benign	Het

Other mutations in Slc19a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03066:Slc19a3	APN	1	83014836	missense	probably damaging	0.99
tag	UTSW	1	83026260	missense	probably damaging	1.00
R0437:Slc19a3	UTSW	1	83022565	missense	probably benign	0.00
R0526:Slc19a3	UTSW	1	83022733	missense	probably damaging	1.00
R1160:Slc19a3	UTSW	1	83022692	missense	possibly damaging	0.85
R1306:Slc19a3	UTSW	1	83022762	missense	probably damaging	1.00
R1832:Slc19a3	UTSW	1	83022747	missense	probably damaging	0.99
R1938:Slc19a3	UTSW	1	83019368	missense	possibly damaging	0.76
R1961:Slc19a3	UTSW	1	83022798	missense	probably benign	0.00
R2058:Slc19a3	UTSW	1	83014791	missense	probably damaging	0.98
R2200:Slc19a3	UTSW	1	83022943	missense	probably damaging	0.96
R2245:Slc19a3	UTSW	1	83013970	missense	possibly damaging	0.84
R2261:Slc19a3	UTSW	1	83022957	missense	probably damaging	1.00
R2404:Slc19a3	UTSW	1	83023035	missense	probably benign	0.16
R3891:Slc19a3	UTSW	1	83022957	missense	probably damaging	1.00
R3892:Slc19a3	UTSW	1	83022957	missense	probably damaging	1.00
R3907:Slc19a3	UTSW	1	83014813	missense	possibly damaging	0.76
R3912:Slc19a3	UTSW	1	83022703	missense	probably benign	0.09
R3922:Slc19a3	UTSW	1	83022957	missense	probably damaging	1.00
R3923:Slc19a3	UTSW	1	83022957	missense	probably damaging	1.00
R3961:Slc19a3	UTSW	1	83022957	missense	probably damaging	1.00
R4083:Slc19a3	UTSW	1	83022957	missense	probably damaging	1.00
R4107:Slc19a3	UTSW	1	83022957	missense	probably damaging	1.00
R4109:Slc19a3	UTSW	1	83022957	missense	probably damaging	1.00
R4667:Slc19a3	UTSW	1	83022799	missense	probably benign
R4768:Slc19a3	UTSW	1	83023113	missense	probably damaging	1.00
R4769:Slc19a3	UTSW	1	83019341	missense	probably damaging	1.00
R5001:Slc19a3	UTSW	1	83022620	missense	probably benign	0.33
R5538:Slc19a3	UTSW	1	83022561	missense	possibly damaging	0.51
R5588:Slc19a3	UTSW	1	83023055	nonsense	probably null
R6143:Slc19a3	UTSW	1	83026339	missense	probably benign	0.00
R6546:Slc19a3	UTSW	1	83026360	missense	probably benign	0.02
R6547:Slc19a3	UTSW	1	83022900	missense	probably damaging	1.00
R7059:Slc19a3	UTSW	1	83022369	missense	probably damaging	1.00
R7497:Slc19a3	UTSW	1	83013928	missense	probably damaging	1.00
R7509:Slc19a3	UTSW	1	83026260	missense	probably damaging	1.00
R7584:Slc19a3	UTSW	1	83022748	missense	possibly damaging	0.79
R7810:Slc19a3	UTSW	1	83019441	missense	probably benign	0.02
R8150:Slc19a3	UTSW	1	83022495	missense	probably damaging	1.00
R8412:Slc19a3	UTSW	1	83014812	missense	probably damaging	0.97
R8970:Slc19a3	UTSW	1	83023101	missense	probably damaging	1.00
R9314:Slc19a3	UTSW	1	83022373	missense	possibly damaging	0.62
R9671:Slc19a3	UTSW	1	83022576	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGTATGGCAGGTTCGTCAGG -3'
(R):5'- ATGTGTTGTGCTTCTGACCATACTTAC -3'

Sequencing Primer
(F):5'- GCAGGTTCGTCAGGGATAC -3'
(R):5'- GACAAATGAGATCCTTCCTGTTTGG -3'

Posted On

2015-06-12