Incidental Mutation 'R4107:Slc19a3'
ID 321408
Institutional Source Beutler Lab
Gene Symbol Slc19a3
Ensembl Gene ENSMUSG00000038496
Gene Name solute carrier family 19, member 3
Synonyms ThTr2, A230084E24Rik
MMRRC Submission 040986-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.129) question?
Stock # R4107 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 82990244-83016169 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 83000678 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 113 (F113Y)
Ref Sequence ENSEMBL: ENSMUSP00000126646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045560] [ENSMUST00000164473]
AlphaFold Q99PL8
Predicted Effect probably damaging
Transcript: ENSMUST00000045560
AA Change: F113Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041683
Gene: ENSMUSG00000038496
AA Change: F113Y

DomainStartEndE-ValueType
Pfam:Folate_carrier 11 435 1.4e-178 PFAM
Pfam:MFS_1 16 416 1.6e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142805
Predicted Effect probably damaging
Transcript: ENSMUST00000164473
AA Change: F113Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126646
Gene: ENSMUSG00000038496
AA Change: F113Y

DomainStartEndE-ValueType
Pfam:Folate_carrier 11 435 1.3e-178 PFAM
Pfam:MFS_1 16 416 1.9e-17 PFAM
Meta Mutation Damage Score 0.4327 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed transmembrane thiamine transporter that lacks folate transport activity. Mutations in this gene cause biotin-responsive basal ganglia disease (BBGD); a recessive disorder manifested in childhood that progresses to chronic encephalopathy, dystonia, quadriparesis, and death if untreated. Patients with BBGD have bilateral necrosis in the head of the caudate nucleus and in the putamen. Administration of high doses of biotin in the early progression of the disorder eliminates pathological symptoms while delayed treatment results in residual paraparesis, mild mental retardation, or dystonia. Administration of thiamine is ineffective in the treatment of this disorder. Experiments have failed to show that this protein can transport biotin. Mutations in this gene also cause a Wernicke's-like encephalopathy.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death within a year of age, impaired thiamin uptake, lethargy, cachexia, injured liver parenchyma, hepatic necrosis, liver and kidney inflammmation, and nephrosclerosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 G T 5: 121,769,527 (GRCm39) S643Y probably damaging Het
Acox3 T C 5: 35,758,896 (GRCm39) F369S probably damaging Het
Arhgap31 A G 16: 38,422,788 (GRCm39) S1093P probably damaging Het
Armc3 G A 2: 19,293,720 (GRCm39) V504M probably benign Het
Ccdc39 A G 3: 33,879,628 (GRCm39) L480P probably damaging Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Cox5b-ps T C 13: 21,685,507 (GRCm39) T28A probably benign Het
Cyp2j7 T C 4: 96,087,687 (GRCm39) T408A possibly damaging Het
Eml5 T C 12: 98,807,807 (GRCm39) probably null Het
Enc1 C A 13: 97,381,646 (GRCm39) A52E probably damaging Het
Fhod1 T C 8: 106,064,670 (GRCm39) probably benign Het
Itprid2 T G 2: 79,475,175 (GRCm39) L378R probably damaging Het
Kmt2c A G 5: 25,503,918 (GRCm39) S3797P possibly damaging Het
Kntc1 T A 5: 123,900,661 (GRCm39) I253N probably damaging Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Mta3 A G 17: 84,070,343 (GRCm39) D16G probably benign Het
Nlrp4f C A 13: 65,330,879 (GRCm39) C838F probably benign Het
Or5aq7 T A 2: 86,937,999 (GRCm39) H244L probably damaging Het
Pou4f3 A G 18: 42,528,987 (GRCm39) K310R probably damaging Het
Reln C A 5: 22,239,582 (GRCm39) C895F probably damaging Het
Rnasel A G 1: 153,630,542 (GRCm39) T353A probably benign Het
Rpusd4 T C 9: 35,186,424 (GRCm39) L320P probably damaging Het
Stbd1 A G 5: 92,753,139 (GRCm39) R210G probably benign Het
Sult6b1 G T 17: 79,214,291 (GRCm39) T6N probably damaging Het
Tas1r2 G A 4: 139,387,363 (GRCm39) R245H probably benign Het
Tpo G A 12: 30,142,585 (GRCm39) P713L probably damaging Het
Trim68 G T 7: 102,327,658 (GRCm39) H432N probably benign Het
Ttn T C 2: 76,569,485 (GRCm39) Q18809R probably damaging Het
Xcr1 A G 9: 123,685,153 (GRCm39) I203T possibly damaging Het
Zfp407 T A 18: 84,361,132 (GRCm39) T1721S possibly damaging Het
Other mutations in Slc19a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03066:Slc19a3 APN 1 82,992,557 (GRCm39) missense probably damaging 0.99
tag UTSW 1 83,003,981 (GRCm39) missense probably damaging 1.00
R0437:Slc19a3 UTSW 1 83,000,286 (GRCm39) missense probably benign 0.00
R0526:Slc19a3 UTSW 1 83,000,454 (GRCm39) missense probably damaging 1.00
R1160:Slc19a3 UTSW 1 83,000,413 (GRCm39) missense possibly damaging 0.85
R1306:Slc19a3 UTSW 1 83,000,483 (GRCm39) missense probably damaging 1.00
R1832:Slc19a3 UTSW 1 83,000,468 (GRCm39) missense probably damaging 0.99
R1938:Slc19a3 UTSW 1 82,997,089 (GRCm39) missense possibly damaging 0.76
R1961:Slc19a3 UTSW 1 83,000,519 (GRCm39) missense probably benign 0.00
R2058:Slc19a3 UTSW 1 82,992,512 (GRCm39) missense probably damaging 0.98
R2200:Slc19a3 UTSW 1 83,000,664 (GRCm39) missense probably damaging 0.96
R2245:Slc19a3 UTSW 1 82,991,691 (GRCm39) missense possibly damaging 0.84
R2261:Slc19a3 UTSW 1 83,000,678 (GRCm39) missense probably damaging 1.00
R2404:Slc19a3 UTSW 1 83,000,756 (GRCm39) missense probably benign 0.16
R3891:Slc19a3 UTSW 1 83,000,678 (GRCm39) missense probably damaging 1.00
R3892:Slc19a3 UTSW 1 83,000,678 (GRCm39) missense probably damaging 1.00
R3907:Slc19a3 UTSW 1 82,992,534 (GRCm39) missense possibly damaging 0.76
R3912:Slc19a3 UTSW 1 83,000,424 (GRCm39) missense probably benign 0.09
R3922:Slc19a3 UTSW 1 83,000,678 (GRCm39) missense probably damaging 1.00
R3923:Slc19a3 UTSW 1 83,000,678 (GRCm39) missense probably damaging 1.00
R3961:Slc19a3 UTSW 1 83,000,678 (GRCm39) missense probably damaging 1.00
R4083:Slc19a3 UTSW 1 83,000,678 (GRCm39) missense probably damaging 1.00
R4106:Slc19a3 UTSW 1 83,000,678 (GRCm39) missense probably damaging 1.00
R4109:Slc19a3 UTSW 1 83,000,678 (GRCm39) missense probably damaging 1.00
R4667:Slc19a3 UTSW 1 83,000,520 (GRCm39) missense probably benign
R4768:Slc19a3 UTSW 1 83,000,834 (GRCm39) missense probably damaging 1.00
R4769:Slc19a3 UTSW 1 82,997,062 (GRCm39) missense probably damaging 1.00
R5001:Slc19a3 UTSW 1 83,000,341 (GRCm39) missense probably benign 0.33
R5538:Slc19a3 UTSW 1 83,000,282 (GRCm39) missense possibly damaging 0.51
R5588:Slc19a3 UTSW 1 83,000,776 (GRCm39) nonsense probably null
R6143:Slc19a3 UTSW 1 83,004,060 (GRCm39) missense probably benign 0.00
R6546:Slc19a3 UTSW 1 83,004,081 (GRCm39) missense probably benign 0.02
R6547:Slc19a3 UTSW 1 83,000,621 (GRCm39) missense probably damaging 1.00
R7059:Slc19a3 UTSW 1 83,000,090 (GRCm39) missense probably damaging 1.00
R7497:Slc19a3 UTSW 1 82,991,649 (GRCm39) missense probably damaging 1.00
R7509:Slc19a3 UTSW 1 83,003,981 (GRCm39) missense probably damaging 1.00
R7584:Slc19a3 UTSW 1 83,000,469 (GRCm39) missense possibly damaging 0.79
R7810:Slc19a3 UTSW 1 82,997,162 (GRCm39) missense probably benign 0.02
R8150:Slc19a3 UTSW 1 83,000,216 (GRCm39) missense probably damaging 1.00
R8412:Slc19a3 UTSW 1 82,992,533 (GRCm39) missense probably damaging 0.97
R8970:Slc19a3 UTSW 1 83,000,822 (GRCm39) missense probably damaging 1.00
R9314:Slc19a3 UTSW 1 83,000,094 (GRCm39) missense possibly damaging 0.62
R9671:Slc19a3 UTSW 1 83,000,297 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TATGGCAGGTTCGTCAGGGATAC -3'
(R):5'- AAATGTGTTGTGCTTCTGACC -3'

Sequencing Primer
(F):5'- ATACTCCGACAGTAGCTG -3'
(R):5'- GACAAATGAGATCCTTCCTGTTTGG -3'
Posted On 2015-06-12