Incidental Mutation 'R4107:Rnasel'
ID321409
Institutional Source Beutler Lab
Gene Symbol Rnasel
Ensembl Gene ENSMUSG00000066800
Gene Nameribonuclease L (2', 5'-oligoisoadenylate synthetase-dependent)
Synonyms2-5A-dependent RNAase, E230029I04Rik
MMRRC Submission 040986-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R4107 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location153749426-153764221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 153754796 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 353 (T353A)
Ref Sequence ENSEMBL: ENSMUSP00000138752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086209] [ENSMUST00000182538] [ENSMUST00000182722] [ENSMUST00000183241]
Predicted Effect probably benign
Transcript: ENSMUST00000086209
AA Change: T353A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000083385
Gene: ENSMUSG00000066800
AA Change: T353A

DomainStartEndE-ValueType
ANK 24 53 6.07e0 SMART
ANK 58 87 6.65e-6 SMART
ANK 91 120 2.73e-2 SMART
ANK 124 153 2.13e-4 SMART
ANK 167 197 6.36e-3 SMART
ANK 201 234 1.06e1 SMART
ANK 238 268 4.13e-2 SMART
ANK 272 301 7.3e-3 SMART
Pfam:Pkinase 365 521 4.9e-19 PFAM
Pfam:Pkinase_Tyr 365 523 6.1e-14 PFAM
Pfam:Kdo 451 546 8e-8 PFAM
PUG 656 707 2.33e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182131
Predicted Effect probably benign
Transcript: ENSMUST00000182538
SMART Domains Protein: ENSMUSP00000138734
Gene: ENSMUSG00000066800

DomainStartEndE-ValueType
PUG 148 199 2.33e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182722
AA Change: T353A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000138247
Gene: ENSMUSG00000066800
AA Change: T353A

DomainStartEndE-ValueType
ANK 24 53 6.07e0 SMART
ANK 58 87 6.65e-6 SMART
ANK 91 120 2.73e-2 SMART
ANK 124 153 2.13e-4 SMART
ANK 167 197 6.36e-3 SMART
ANK 201 234 1.06e1 SMART
ANK 238 268 4.13e-2 SMART
ANK 272 301 7.3e-3 SMART
Pfam:Pkinase_Tyr 364 523 2.4e-13 PFAM
Pfam:Pkinase 365 520 2.1e-18 PFAM
Pfam:Kdo 452 546 9.3e-7 PFAM
Pfam:Ribonuc_2-5A 589 651 2.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183241
AA Change: T353A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000138752
Gene: ENSMUSG00000066800
AA Change: T353A

DomainStartEndE-ValueType
ANK 24 53 6.07e0 SMART
ANK 58 87 6.65e-6 SMART
ANK 91 120 2.73e-2 SMART
ANK 124 153 2.13e-4 SMART
ANK 167 197 6.36e-3 SMART
ANK 201 234 1.06e1 SMART
ANK 238 268 4.13e-2 SMART
ANK 272 301 7.3e-3 SMART
Pfam:Pkinase_Tyr 364 523 2.6e-13 PFAM
Pfam:Pkinase 365 517 2.4e-18 PFAM
Pfam:Kdo 452 546 9.7e-7 PFAM
Pfam:Ribonuc_2-5A 589 674 1.7e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187415
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the interferon-regulated 2-5A system that functions in the antiviral and antiproliferative roles of interferons. Mutations in this gene have been associated with predisposition to prostate cancer and this gene is a candidate for the hereditary prostate cancer 1 (HPC1) allele. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have an enlarged spleen and increased succeptibility to viral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 G T 5: 121,631,464 S643Y probably damaging Het
Acox3 T C 5: 35,601,552 F369S probably damaging Het
Arhgap31 A G 16: 38,602,426 S1093P probably damaging Het
Armc3 G A 2: 19,288,909 V504M probably benign Het
Ccdc39 A G 3: 33,825,479 L480P probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp2j7 T C 4: 96,199,450 T408A possibly damaging Het
Eml5 T C 12: 98,841,548 probably null Het
Enc1 C A 13: 97,245,138 A52E probably damaging Het
Fhod1 T C 8: 105,338,038 probably benign Het
Gm11273 T C 13: 21,501,337 T28A probably benign Het
Kmt2c A G 5: 25,298,920 S3797P possibly damaging Het
Kntc1 T A 5: 123,762,598 I253N probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mta3 A G 17: 83,762,914 D16G probably benign Het
Nlrp4f C A 13: 65,183,065 C838F probably benign Het
Olfr259 T A 2: 87,107,655 H244L probably damaging Het
Pou4f3 A G 18: 42,395,922 K310R probably damaging Het
Reln C A 5: 22,034,584 C895F probably damaging Het
Rpusd4 T C 9: 35,275,128 L320P probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Ssfa2 T G 2: 79,644,831 L378R probably damaging Het
Stbd1 A G 5: 92,605,280 R210G probably benign Het
Sult6b1 G T 17: 78,906,862 T6N probably damaging Het
Tas1r2 G A 4: 139,660,052 R245H probably benign Het
Tpo G A 12: 30,092,586 P713L probably damaging Het
Trim68 G T 7: 102,678,451 H432N probably benign Het
Ttn T C 2: 76,739,141 Q18809R probably damaging Het
Xcr1 A G 9: 123,856,088 I203T possibly damaging Het
Zfp407 T A 18: 84,343,007 T1721S possibly damaging Het
Other mutations in Rnasel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Rnasel APN 1 153758384 missense probably benign 0.04
IGL02662:Rnasel APN 1 153754111 missense probably damaging 1.00
IGL03215:Rnasel APN 1 153758555 missense probably damaging 1.00
R0022:Rnasel UTSW 1 153760775 missense probably damaging 1.00
R0022:Rnasel UTSW 1 153760775 missense probably damaging 1.00
R0028:Rnasel UTSW 1 153754719 missense probably benign 0.04
R0116:Rnasel UTSW 1 153754512 missense probably damaging 1.00
R0981:Rnasel UTSW 1 153759599 missense probably benign 0.03
R1523:Rnasel UTSW 1 153756013 missense probably damaging 0.98
R1538:Rnasel UTSW 1 153760794 missense possibly damaging 0.62
R1646:Rnasel UTSW 1 153755054 missense probably damaging 1.00
R1793:Rnasel UTSW 1 153754423 missense probably damaging 0.98
R1843:Rnasel UTSW 1 153754674 missense possibly damaging 0.94
R2158:Rnasel UTSW 1 153754901 missense probably damaging 1.00
R2434:Rnasel UTSW 1 153754650 missense probably damaging 1.00
R2895:Rnasel UTSW 1 153760776 missense probably damaging 1.00
R5013:Rnasel UTSW 1 153753931 missense probably damaging 0.99
R5015:Rnasel UTSW 1 153754097 nonsense probably null
R5540:Rnasel UTSW 1 153755144 nonsense probably null
R5688:Rnasel UTSW 1 153753706 start gained probably benign
R5955:Rnasel UTSW 1 153754400 missense probably benign 0.05
R6131:Rnasel UTSW 1 153754460 missense probably damaging 1.00
R6164:Rnasel UTSW 1 153754392 missense probably benign 0.32
R6395:Rnasel UTSW 1 153762121 missense probably damaging 0.99
R6483:Rnasel UTSW 1 153754686 missense probably benign 0.10
R7470:Rnasel UTSW 1 153754031 missense probably benign 0.00
R7538:Rnasel UTSW 1 153754560 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCTCTGCTAATTGCTGTTGATAAAC -3'
(R):5'- TCCCGCAGACAAGAGACTTC -3'

Sequencing Primer
(F):5'- CCAGTTGCTTCTTGAAAAGGGAGC -3'
(R):5'- AGAGACTTCCTTACATCCACGTGG -3'
Posted On2015-06-12