Incidental Mutation 'R4107:Olfr259'
ID321414
Institutional Source Beutler Lab
Gene Symbol Olfr259
Ensembl Gene ENSMUSG00000075160
Gene Nameolfactory receptor 259
SynonymsGA_x6K02T2N869-1820-882, MOR172-3
MMRRC Submission 040986-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R4107 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location87104578-87114567 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87107655 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 244 (H244L)
Ref Sequence ENSEMBL: ENSMUSP00000151207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099862] [ENSMUST00000213978] [ENSMUST00000215828] [ENSMUST00000216088]
Predicted Effect probably damaging
Transcript: ENSMUST00000099862
AA Change: H244L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097448
Gene: ENSMUSG00000075160
AA Change: H244L

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.6e-53 PFAM
Pfam:7tm_1 41 290 5.3e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213978
AA Change: H244L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000215828
AA Change: H244L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000216088
AA Change: H244L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 G T 5: 121,631,464 S643Y probably damaging Het
Acox3 T C 5: 35,601,552 F369S probably damaging Het
Arhgap31 A G 16: 38,602,426 S1093P probably damaging Het
Armc3 G A 2: 19,288,909 V504M probably benign Het
Ccdc39 A G 3: 33,825,479 L480P probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp2j7 T C 4: 96,199,450 T408A possibly damaging Het
Eml5 T C 12: 98,841,548 probably null Het
Enc1 C A 13: 97,245,138 A52E probably damaging Het
Fhod1 T C 8: 105,338,038 probably benign Het
Gm11273 T C 13: 21,501,337 T28A probably benign Het
Kmt2c A G 5: 25,298,920 S3797P possibly damaging Het
Kntc1 T A 5: 123,762,598 I253N probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mta3 A G 17: 83,762,914 D16G probably benign Het
Nlrp4f C A 13: 65,183,065 C838F probably benign Het
Pou4f3 A G 18: 42,395,922 K310R probably damaging Het
Reln C A 5: 22,034,584 C895F probably damaging Het
Rnasel A G 1: 153,754,796 T353A probably benign Het
Rpusd4 T C 9: 35,275,128 L320P probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Ssfa2 T G 2: 79,644,831 L378R probably damaging Het
Stbd1 A G 5: 92,605,280 R210G probably benign Het
Sult6b1 G T 17: 78,906,862 T6N probably damaging Het
Tas1r2 G A 4: 139,660,052 R245H probably benign Het
Tpo G A 12: 30,092,586 P713L probably damaging Het
Trim68 G T 7: 102,678,451 H432N probably benign Het
Ttn T C 2: 76,739,141 Q18809R probably damaging Het
Xcr1 A G 9: 123,856,088 I203T possibly damaging Het
Zfp407 T A 18: 84,343,007 T1721S possibly damaging Het
Other mutations in Olfr259
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02264:Olfr259 APN 2 87107441 utr 3 prime probably benign
IGL02540:Olfr259 APN 2 87108042 missense probably damaging 1.00
IGL02572:Olfr259 APN 2 87108366 missense possibly damaging 0.63
R2091:Olfr259 UTSW 2 87108262 missense probably damaging 1.00
R2928:Olfr259 UTSW 2 87107763 missense possibly damaging 0.88
R4332:Olfr259 UTSW 2 87107745 missense possibly damaging 0.79
R4929:Olfr259 UTSW 2 87108183 missense possibly damaging 0.79
R5027:Olfr259 UTSW 2 87107806 missense probably benign 0.40
R6005:Olfr259 UTSW 2 87108063 missense probably benign 0.00
R6191:Olfr259 UTSW 2 87107952 missense probably damaging 1.00
R6358:Olfr259 UTSW 2 87108434 start gained probably benign
R6399:Olfr259 UTSW 2 87107986 missense probably benign 0.21
R6554:Olfr259 UTSW 2 87107626 missense probably benign 0.34
R7836:Olfr259 UTSW 2 87107517 missense probably damaging 1.00
R7881:Olfr259 UTSW 2 87108057 missense probably damaging 0.99
R8069:Olfr259 UTSW 2 87108067 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGGGGCATTTCTCTCCC -3'
(R):5'- CTGTGGTCCAAACATTGTGAATC -3'

Sequencing Primer
(F):5'- CCACAAATTAACTTCTTGGCTGC -3'
(R):5'- GTGGTCCAAACATTGTGAATCATTTC -3'
Posted On2015-06-12