Incidental Mutation 'R4107:Tas1r2'
ID321418
Institutional Source Beutler Lab
Gene Symbol Tas1r2
Ensembl Gene ENSMUSG00000028738
Gene Nametaste receptor, type 1, member 2
SynonymsGpr71, TR2, T1r2
MMRRC Submission 040986-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R4107 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location139653538-139670280 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 139660052 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 245 (R245H)
Ref Sequence ENSEMBL: ENSMUSP00000127737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030510] [ENSMUST00000166773] [ENSMUST00000178644]
Predicted Effect probably benign
Transcript: ENSMUST00000030510
AA Change: R274H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000030510
Gene: ENSMUSG00000028738
AA Change: R274H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 73 459 2e-90 PFAM
Pfam:NCD3G 495 548 2.4e-17 PFAM
Pfam:7tm_3 581 818 2.8e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166773
AA Change: R245H

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000127737
Gene: ENSMUSG00000028738
AA Change: R245H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 73 213 5.3e-38 PFAM
Pfam:ANF_receptor 217 429 8.4e-31 PFAM
Pfam:NCD3G 466 519 7.4e-19 PFAM
Pfam:7tm_3 550 790 3e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178644
SMART Domains Protein: ENSMUSP00000136776
Gene: ENSMUSG00000094439

DomainStartEndE-ValueType
SCOP:d1lbva_ 1 60 5e-3 SMART
Pfam:Filament 165 253 7.3e-13 PFAM
low complexity region 255 268 N/A INTRINSIC
Meta Mutation Damage Score 0.1171 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant mice show diminished behavioral and nervous responses to sweet tastants. Response to umami tastants is unimpaired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 G T 5: 121,631,464 S643Y probably damaging Het
Acox3 T C 5: 35,601,552 F369S probably damaging Het
Arhgap31 A G 16: 38,602,426 S1093P probably damaging Het
Armc3 G A 2: 19,288,909 V504M probably benign Het
Ccdc39 A G 3: 33,825,479 L480P probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp2j7 T C 4: 96,199,450 T408A possibly damaging Het
Eml5 T C 12: 98,841,548 probably null Het
Enc1 C A 13: 97,245,138 A52E probably damaging Het
Fhod1 T C 8: 105,338,038 probably benign Het
Gm11273 T C 13: 21,501,337 T28A probably benign Het
Kmt2c A G 5: 25,298,920 S3797P possibly damaging Het
Kntc1 T A 5: 123,762,598 I253N probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mta3 A G 17: 83,762,914 D16G probably benign Het
Nlrp4f C A 13: 65,183,065 C838F probably benign Het
Olfr259 T A 2: 87,107,655 H244L probably damaging Het
Pou4f3 A G 18: 42,395,922 K310R probably damaging Het
Reln C A 5: 22,034,584 C895F probably damaging Het
Rnasel A G 1: 153,754,796 T353A probably benign Het
Rpusd4 T C 9: 35,275,128 L320P probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Ssfa2 T G 2: 79,644,831 L378R probably damaging Het
Stbd1 A G 5: 92,605,280 R210G probably benign Het
Sult6b1 G T 17: 78,906,862 T6N probably damaging Het
Tpo G A 12: 30,092,586 P713L probably damaging Het
Trim68 G T 7: 102,678,451 H432N probably benign Het
Ttn T C 2: 76,739,141 Q18809R probably damaging Het
Xcr1 A G 9: 123,856,088 I203T possibly damaging Het
Zfp407 T A 18: 84,343,007 T1721S possibly damaging Het
Other mutations in Tas1r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Tas1r2 APN 4 139660291 missense probably benign 0.03
IGL00952:Tas1r2 APN 4 139655252 missense probably benign 0.00
IGL00972:Tas1r2 APN 4 139660036 missense probably damaging 0.99
IGL01939:Tas1r2 APN 4 139669177 missense probably damaging 1.00
IGL02247:Tas1r2 APN 4 139669516 missense probably damaging 1.00
IGL02663:Tas1r2 APN 4 139660282 missense probably benign
IGL03155:Tas1r2 APN 4 139669156 missense possibly damaging 0.95
R0395:Tas1r2 UTSW 4 139655354 missense possibly damaging 0.86
R0798:Tas1r2 UTSW 4 139669713 missense probably damaging 1.00
R1221:Tas1r2 UTSW 4 139669125 missense probably benign 0.00
R1223:Tas1r2 UTSW 4 139660204 missense probably damaging 1.00
R1261:Tas1r2 UTSW 4 139655288 missense probably damaging 0.99
R1262:Tas1r2 UTSW 4 139655288 missense probably damaging 0.99
R1330:Tas1r2 UTSW 4 139669329 missense probably benign 0.05
R1466:Tas1r2 UTSW 4 139669411 missense probably damaging 1.00
R1466:Tas1r2 UTSW 4 139669411 missense probably damaging 1.00
R1879:Tas1r2 UTSW 4 139669695 missense probably damaging 1.00
R2112:Tas1r2 UTSW 4 139655355 missense probably benign 0.00
R2156:Tas1r2 UTSW 4 139669041 missense possibly damaging 0.79
R2509:Tas1r2 UTSW 4 139659851 missense probably damaging 1.00
R2510:Tas1r2 UTSW 4 139659851 missense probably damaging 1.00
R2511:Tas1r2 UTSW 4 139659851 missense probably damaging 1.00
R3429:Tas1r2 UTSW 4 139669575 missense probably damaging 1.00
R3430:Tas1r2 UTSW 4 139669575 missense probably damaging 1.00
R3703:Tas1r2 UTSW 4 139667418 missense probably damaging 1.00
R4105:Tas1r2 UTSW 4 139660052 missense probably benign 0.06
R4106:Tas1r2 UTSW 4 139660052 missense probably benign 0.06
R4614:Tas1r2 UTSW 4 139659787 missense probably damaging 1.00
R4811:Tas1r2 UTSW 4 139669000 missense probably damaging 1.00
R5314:Tas1r2 UTSW 4 139655361 missense probably damaging 1.00
R5461:Tas1r2 UTSW 4 139660009 missense probably benign 0.01
R5639:Tas1r2 UTSW 4 139659796 missense probably damaging 1.00
R5703:Tas1r2 UTSW 4 139667336 missense probably damaging 1.00
R6176:Tas1r2 UTSW 4 139668888 missense probably damaging 1.00
R6297:Tas1r2 UTSW 4 139662050 missense possibly damaging 0.47
R6441:Tas1r2 UTSW 4 139669156 missense probably damaging 0.99
R6748:Tas1r2 UTSW 4 139669611 missense probably damaging 0.98
R6863:Tas1r2 UTSW 4 139669719 missense probably damaging 1.00
R6975:Tas1r2 UTSW 4 139669720 missense probably damaging 1.00
R7106:Tas1r2 UTSW 4 139662049 missense probably benign
R7265:Tas1r2 UTSW 4 139669652 missense probably benign 0.01
R7580:Tas1r2 UTSW 4 139659745 missense probably benign 0.05
R7651:Tas1r2 UTSW 4 139669627 missense probably benign 0.14
R8041:Tas1r2 UTSW 4 139659979 missense possibly damaging 0.65
Z1088:Tas1r2 UTSW 4 139660424 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGACGATTATGGCCGAGAGAAC -3'
(R):5'- ATACTCTGGCTTGTCGTGGC -3'

Sequencing Primer
(F):5'- TTATGGCCGAGAGAACAGCCAC -3'
(R):5'- ACTCGGAACTGGCTGAAGC -3'
Posted On2015-06-12