Incidental Mutation 'R4107:Stbd1'
ID321422
Institutional Source Beutler Lab
Gene Symbol Stbd1
Ensembl Gene ENSMUSG00000047963
Gene Namestarch binding domain 1
SynonymsD530019K15Rik, D5Ertd593e
MMRRC Submission 040986-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4107 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location92603041-92606579 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92605280 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 210 (R210G)
Ref Sequence ENSEMBL: ENSMUSP00000054322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050952] [ENSMUST00000060930] [ENSMUST00000200941] [ENSMUST00000202332]
Predicted Effect probably benign
Transcript: ENSMUST00000050952
AA Change: R210G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000054322
Gene: ENSMUSG00000047963
AA Change: R210G

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
low complexity region 36 68 N/A INTRINSIC
low complexity region 195 206 N/A INTRINSIC
CBM_2 243 334 2.81e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060930
SMART Domains Protein: ENSMUSP00000063050
Gene: ENSMUSG00000050050

DomainStartEndE-ValueType
Pfam:CCDC158 1 1109 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136004
Predicted Effect probably benign
Transcript: ENSMUST00000200941
SMART Domains Protein: ENSMUSP00000144305
Gene: ENSMUSG00000047963

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 36 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202332
SMART Domains Protein: ENSMUSP00000144467
Gene: ENSMUSG00000047963

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 36 68 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 G T 5: 121,631,464 S643Y probably damaging Het
Acox3 T C 5: 35,601,552 F369S probably damaging Het
Arhgap31 A G 16: 38,602,426 S1093P probably damaging Het
Armc3 G A 2: 19,288,909 V504M probably benign Het
Ccdc39 A G 3: 33,825,479 L480P probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp2j7 T C 4: 96,199,450 T408A possibly damaging Het
Eml5 T C 12: 98,841,548 probably null Het
Enc1 C A 13: 97,245,138 A52E probably damaging Het
Fhod1 T C 8: 105,338,038 probably benign Het
Gm11273 T C 13: 21,501,337 T28A probably benign Het
Kmt2c A G 5: 25,298,920 S3797P possibly damaging Het
Kntc1 T A 5: 123,762,598 I253N probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mta3 A G 17: 83,762,914 D16G probably benign Het
Nlrp4f C A 13: 65,183,065 C838F probably benign Het
Olfr259 T A 2: 87,107,655 H244L probably damaging Het
Pou4f3 A G 18: 42,395,922 K310R probably damaging Het
Reln C A 5: 22,034,584 C895F probably damaging Het
Rnasel A G 1: 153,754,796 T353A probably benign Het
Rpusd4 T C 9: 35,275,128 L320P probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Ssfa2 T G 2: 79,644,831 L378R probably damaging Het
Sult6b1 G T 17: 78,906,862 T6N probably damaging Het
Tas1r2 G A 4: 139,660,052 R245H probably benign Het
Tpo G A 12: 30,092,586 P713L probably damaging Het
Trim68 G T 7: 102,678,451 H432N probably benign Het
Ttn T C 2: 76,739,141 Q18809R probably damaging Het
Xcr1 A G 9: 123,856,088 I203T possibly damaging Het
Zfp407 T A 18: 84,343,007 T1721S possibly damaging Het
Other mutations in Stbd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02718:Stbd1 APN 5 92603218 missense possibly damaging 0.72
R0830:Stbd1 UTSW 5 92605130 missense probably benign 0.00
R1168:Stbd1 UTSW 5 92604936 missense probably benign 0.19
R2936:Stbd1 UTSW 5 92603260 missense possibly damaging 0.93
R5849:Stbd1 UTSW 5 92604995 missense probably benign 0.00
R7011:Stbd1 UTSW 5 92605118 nonsense probably null
R7747:Stbd1 UTSW 5 92605557 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAAGCCCAGGATCTCATGG -3'
(R):5'- CTCATGGTCTCCAGTCACTG -3'

Sequencing Primer
(F):5'- TCTCATGGAGGAGAATGGAGACTC -3'
(R):5'- GTCTCCAGTCACTGCAATGAACTG -3'
Posted On2015-06-12