Incidental Mutation 'R4107:Fhod1'
ID321428
Institutional Source Beutler Lab
Gene Symbol Fhod1
Ensembl Gene ENSMUSG00000014778
Gene Nameformin homology 2 domain containing 1
Synonyms
MMRRC Submission 040986-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock #R4107 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location105329163-105347953 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 105338038 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014922] [ENSMUST00000014922] [ENSMUST00000098453] [ENSMUST00000109372]
Predicted Effect unknown
Transcript: ENSMUST00000014922
AA Change: I145V
SMART Domains Protein: ENSMUSP00000014922
Gene: ENSMUSG00000014778
AA Change: I145V

DomainStartEndE-ValueType
PDB:3DAD|B 1 339 N/A PDB
Blast:Drf_GBD 85 216 1e-48 BLAST
SCOP:d1ee4a_ 120 240 4e-4 SMART
Blast:FH2 231 318 6e-38 BLAST
low complexity region 342 357 N/A INTRINSIC
Blast:FH2 386 483 2e-10 BLAST
low complexity region 514 532 N/A INTRINSIC
low complexity region 573 643 N/A INTRINSIC
FH2 648 1100 3.16e-121 SMART
low complexity region 1119 1130 N/A INTRINSIC
Blast:FH2 1135 1179 1e-6 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000014922
AA Change: I145V
SMART Domains Protein: ENSMUSP00000014922
Gene: ENSMUSG00000014778
AA Change: I145V

DomainStartEndE-ValueType
PDB:3DAD|B 1 339 N/A PDB
Blast:Drf_GBD 85 216 1e-48 BLAST
SCOP:d1ee4a_ 120 240 4e-4 SMART
Blast:FH2 231 318 6e-38 BLAST
low complexity region 342 357 N/A INTRINSIC
Blast:FH2 386 483 2e-10 BLAST
low complexity region 514 532 N/A INTRINSIC
low complexity region 573 643 N/A INTRINSIC
FH2 648 1100 3.16e-121 SMART
low complexity region 1119 1130 N/A INTRINSIC
Blast:FH2 1135 1179 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000098453
SMART Domains Protein: ENSMUSP00000096052
Gene: ENSMUSG00000014856

DomainStartEndE-ValueType
Pfam:DUF788 7 103 3.7e-29 PFAM
low complexity region 118 133 N/A INTRINSIC
low complexity region 135 149 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109372
SMART Domains Protein: ENSMUSP00000104997
Gene: ENSMUSG00000014856

DomainStartEndE-ValueType
Pfam:DUF788 7 103 4.2e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136439
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 G T 5: 121,631,464 S643Y probably damaging Het
Acox3 T C 5: 35,601,552 F369S probably damaging Het
Arhgap31 A G 16: 38,602,426 S1093P probably damaging Het
Armc3 G A 2: 19,288,909 V504M probably benign Het
Ccdc39 A G 3: 33,825,479 L480P probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp2j7 T C 4: 96,199,450 T408A possibly damaging Het
Eml5 T C 12: 98,841,548 probably null Het
Enc1 C A 13: 97,245,138 A52E probably damaging Het
Gm11273 T C 13: 21,501,337 T28A probably benign Het
Kmt2c A G 5: 25,298,920 S3797P possibly damaging Het
Kntc1 T A 5: 123,762,598 I253N probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mta3 A G 17: 83,762,914 D16G probably benign Het
Nlrp4f C A 13: 65,183,065 C838F probably benign Het
Olfr259 T A 2: 87,107,655 H244L probably damaging Het
Pou4f3 A G 18: 42,395,922 K310R probably damaging Het
Reln C A 5: 22,034,584 C895F probably damaging Het
Rnasel A G 1: 153,754,796 T353A probably benign Het
Rpusd4 T C 9: 35,275,128 L320P probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Ssfa2 T G 2: 79,644,831 L378R probably damaging Het
Stbd1 A G 5: 92,605,280 R210G probably benign Het
Sult6b1 G T 17: 78,906,862 T6N probably damaging Het
Tas1r2 G A 4: 139,660,052 R245H probably benign Het
Tpo G A 12: 30,092,586 P713L probably damaging Het
Trim68 G T 7: 102,678,451 H432N probably benign Het
Ttn T C 2: 76,739,141 Q18809R probably damaging Het
Xcr1 A G 9: 123,856,088 I203T possibly damaging Het
Zfp407 T A 18: 84,343,007 T1721S possibly damaging Het
Other mutations in Fhod1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Fhod1 APN 8 105332102 missense possibly damaging 0.66
IGL01149:Fhod1 APN 8 105347807 unclassified probably benign
IGL01325:Fhod1 APN 8 105331649 missense probably benign 0.33
IGL01470:Fhod1 APN 8 105329649 missense probably damaging 1.00
IGL01521:Fhod1 APN 8 105330423 missense probably benign 0.17
IGL01861:Fhod1 APN 8 105331176 missense probably damaging 1.00
IGL02864:Fhod1 APN 8 105337164 unclassified probably benign
IGL02951:Fhod1 APN 8 105331230 missense probably damaging 1.00
reactive UTSW 8 105336434 unclassified probably benign
treason UTSW 8 105337350 unclassified probably benign
R0016:Fhod1 UTSW 8 105331655 missense possibly damaging 0.91
R0016:Fhod1 UTSW 8 105331655 missense possibly damaging 0.91
R0071:Fhod1 UTSW 8 105337225 splice site probably null
R0071:Fhod1 UTSW 8 105337225 splice site probably null
R0498:Fhod1 UTSW 8 105329856 missense probably damaging 1.00
R1234:Fhod1 UTSW 8 105337163 unclassified probably benign
R1465:Fhod1 UTSW 8 105338914 unclassified probably benign
R1465:Fhod1 UTSW 8 105338914 unclassified probably benign
R1485:Fhod1 UTSW 8 105336798 critical splice acceptor site probably null
R1585:Fhod1 UTSW 8 105337325 unclassified probably benign
R1615:Fhod1 UTSW 8 105347831 unclassified probably benign
R1778:Fhod1 UTSW 8 105329677 missense probably damaging 1.00
R1781:Fhod1 UTSW 8 105347789 unclassified probably benign
R2291:Fhod1 UTSW 8 105336964 unclassified probably benign
R2864:Fhod1 UTSW 8 105332911 missense probably null 0.97
R2865:Fhod1 UTSW 8 105332911 missense probably null 0.97
R3775:Fhod1 UTSW 8 105331638 unclassified probably benign
R4422:Fhod1 UTSW 8 105337351 unclassified probably benign
R4423:Fhod1 UTSW 8 105337351 unclassified probably benign
R4424:Fhod1 UTSW 8 105337351 unclassified probably benign
R4425:Fhod1 UTSW 8 105337351 unclassified probably benign
R4641:Fhod1 UTSW 8 105329592 missense probably damaging 1.00
R4724:Fhod1 UTSW 8 105337861 unclassified probably benign
R4757:Fhod1 UTSW 8 105347811 unclassified probably benign
R5004:Fhod1 UTSW 8 105336945 unclassified probably benign
R5082:Fhod1 UTSW 8 105330513 missense probably damaging 1.00
R6033:Fhod1 UTSW 8 105336434 unclassified probably benign
R6033:Fhod1 UTSW 8 105336434 unclassified probably benign
R6298:Fhod1 UTSW 8 105337148 unclassified probably benign
R6320:Fhod1 UTSW 8 105337350 unclassified probably benign
R6362:Fhod1 UTSW 8 105331641 critical splice donor site probably null
R6449:Fhod1 UTSW 8 105330237 missense probably damaging 1.00
R6736:Fhod1 UTSW 8 105337890 unclassified probably benign
R6816:Fhod1 UTSW 8 105330544 missense probably benign 0.10
R6955:Fhod1 UTSW 8 105333007 missense probably benign 0.00
R7073:Fhod1 UTSW 8 105337139 missense unknown
R7567:Fhod1 UTSW 8 105347837 missense unknown
R7697:Fhod1 UTSW 8 105347931 unclassified probably benign
R7789:Fhod1 UTSW 8 105330108 missense probably damaging 1.00
R7894:Fhod1 UTSW 8 105331157 missense probably damaging 1.00
R8105:Fhod1 UTSW 8 105337215 missense unknown
Predicted Primers PCR Primer
(F):5'- TCGAAGGATGTAGCTCTGGTAG -3'
(R):5'- TTCTGGGTCAGGATCCATGC -3'

Sequencing Primer
(F):5'- AGTTGTGGTCTGCAGCAGC -3'
(R):5'- CTGGACTGCAGTCATGGTGAC -3'
Posted On2015-06-12