Incidental Mutation 'R4107:Xcr1'
ID321430
Institutional Source Beutler Lab
Gene Symbol Xcr1
Ensembl Gene ENSMUSG00000060509
Gene Namechemokine (C motif) receptor 1
SynonymsCcxcr1, XCR1, C motif-1/lymphotactin receptor, GPR5
MMRRC Submission 040986-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R4107 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location123852315-123862029 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123856088 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 203 (I203T)
Ref Sequence ENSEMBL: ENSMUSP00000138255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084715] [ENSMUST00000167595] [ENSMUST00000182350] [ENSMUST00000184082]
Predicted Effect probably benign
Transcript: ENSMUST00000084715
SMART Domains Protein: ENSMUSP00000081764
Gene: ENSMUSG00000025241

DomainStartEndE-ValueType
Pfam:RUN 19 167 4.7e-12 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 223 270 N/A INTRINSIC
coiled coil region 348 1110 N/A INTRINSIC
FYVE 1124 1191 2.69e-16 SMART
PDB:1OLM|E 1343 1428 1e-5 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000167595
SMART Domains Protein: ENSMUSP00000133222
Gene: ENSMUSG00000025241

DomainStartEndE-ValueType
Pfam:RUN 20 167 7.8e-12 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 223 270 N/A INTRINSIC
coiled coil region 348 1110 N/A INTRINSIC
FYVE 1124 1191 2.69e-16 SMART
PDB:1OLM|E 1343 1428 1e-5 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000182350
AA Change: I203T

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000138255
Gene: ENSMUSG00000060509
AA Change: I203T

DomainStartEndE-ValueType
low complexity region 48 59 N/A INTRINSIC
Pfam:7tm_1 60 295 1.9e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183700
Predicted Effect probably benign
Transcript: ENSMUST00000184082
SMART Domains Protein: ENSMUSP00000139343
Gene: ENSMUSG00000025241

DomainStartEndE-ValueType
Pfam:RUN 7 167 4.5e-12 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 223 270 N/A INTRINSIC
low complexity region 355 366 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a chemokine receptor belonging to the G protein-coupled receptor superfamily. The family members are characterized by the presence of 7 transmembrane domains and numerous conserved amino acids. This receptor is most closely related to RBS11 and the MIP1-alpha/RANTES receptor. It transduces a signal by increasing the intracellular calcium ions level. The viral macrophage inflammatory protein-II is an antagonist of this receptor and blocks signaling. Two alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit reduced CD8+ dendritic cell migration in response to XCL1. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 G T 5: 121,631,464 S643Y probably damaging Het
Acox3 T C 5: 35,601,552 F369S probably damaging Het
Arhgap31 A G 16: 38,602,426 S1093P probably damaging Het
Armc3 G A 2: 19,288,909 V504M probably benign Het
Ccdc39 A G 3: 33,825,479 L480P probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp2j7 T C 4: 96,199,450 T408A possibly damaging Het
Eml5 T C 12: 98,841,548 probably null Het
Enc1 C A 13: 97,245,138 A52E probably damaging Het
Fhod1 T C 8: 105,338,038 probably benign Het
Gm11273 T C 13: 21,501,337 T28A probably benign Het
Kmt2c A G 5: 25,298,920 S3797P possibly damaging Het
Kntc1 T A 5: 123,762,598 I253N probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mta3 A G 17: 83,762,914 D16G probably benign Het
Nlrp4f C A 13: 65,183,065 C838F probably benign Het
Olfr259 T A 2: 87,107,655 H244L probably damaging Het
Pou4f3 A G 18: 42,395,922 K310R probably damaging Het
Reln C A 5: 22,034,584 C895F probably damaging Het
Rnasel A G 1: 153,754,796 T353A probably benign Het
Rpusd4 T C 9: 35,275,128 L320P probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Ssfa2 T G 2: 79,644,831 L378R probably damaging Het
Stbd1 A G 5: 92,605,280 R210G probably benign Het
Sult6b1 G T 17: 78,906,862 T6N probably damaging Het
Tas1r2 G A 4: 139,660,052 R245H probably benign Het
Tpo G A 12: 30,092,586 P713L probably damaging Het
Trim68 G T 7: 102,678,451 H432N probably benign Het
Ttn T C 2: 76,739,141 Q18809R probably damaging Het
Zfp407 T A 18: 84,343,007 T1721S possibly damaging Het
Other mutations in Xcr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03324:Xcr1 APN 9 123856484 missense probably benign 0.26
R0049:Xcr1 UTSW 9 123855875 missense possibly damaging 0.49
R0049:Xcr1 UTSW 9 123855875 missense possibly damaging 0.49
R0318:Xcr1 UTSW 9 123856154 missense possibly damaging 0.92
R0683:Xcr1 UTSW 9 123855875 missense probably benign 0.03
R4127:Xcr1 UTSW 9 123856496 missense probably damaging 1.00
R4859:Xcr1 UTSW 9 123856647 missense probably benign
R5408:Xcr1 UTSW 9 123856566 missense probably benign 0.00
R5419:Xcr1 UTSW 9 123856310 missense probably benign 0.06
R5817:Xcr1 UTSW 9 123855857 missense possibly damaging 0.94
R6051:Xcr1 UTSW 9 123856116 missense probably benign 0.01
R6384:Xcr1 UTSW 9 123855782 missense probably damaging 1.00
R6395:Xcr1 UTSW 9 123855789 missense probably damaging 0.96
R6528:Xcr1 UTSW 9 123855983 missense probably damaging 1.00
R6594:Xcr1 UTSW 9 123856244 missense probably benign 0.00
R6990:Xcr1 UTSW 9 123856235 missense probably benign 0.15
R7648:Xcr1 UTSW 9 123856592 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- ATGTCCAGTTGCTGAAGGC -3'
(R):5'- CTGTAGTGAGCCCCATCTCTAC -3'

Sequencing Primer
(F):5'- AGTTGCTGAAGGCTCTCACAG -3'
(R):5'- AGTGAGCCCCATCTCTACTCTGG -3'
Posted On2015-06-12