Incidental Mutation 'R4107:Gm11273'
ID321434
Institutional Source Beutler Lab
Gene Symbol Gm11273
Ensembl Gene ENSMUSG00000079941
Gene Namepredicted gene 11273
Synonyms
MMRRC Submission 040986-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R4107 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location21501029-21501418 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21501337 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 28 (T28A)
Ref Sequence ENSEMBL: ENSMUSP00000038961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044043] [ENSMUST00000104942]
Predicted Effect probably benign
Transcript: ENSMUST00000044043
AA Change: T28A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038961
Gene: ENSMUSG00000079941
AA Change: T28A

DomainStartEndE-ValueType
Pfam:COX5B 7 129 1.2e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000104942
SMART Domains Protein: ENSMUSP00000100547
Gene: ENSMUSG00000078139

DomainStartEndE-ValueType
Pfam:Fe-S_biosyn 23 125 7e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118425
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202195
AA Change: T31A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224437
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 G T 5: 121,631,464 S643Y probably damaging Het
Acox3 T C 5: 35,601,552 F369S probably damaging Het
Arhgap31 A G 16: 38,602,426 S1093P probably damaging Het
Armc3 G A 2: 19,288,909 V504M probably benign Het
Ccdc39 A G 3: 33,825,479 L480P probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp2j7 T C 4: 96,199,450 T408A possibly damaging Het
Eml5 T C 12: 98,841,548 probably null Het
Enc1 C A 13: 97,245,138 A52E probably damaging Het
Fhod1 T C 8: 105,338,038 probably benign Het
Kmt2c A G 5: 25,298,920 S3797P possibly damaging Het
Kntc1 T A 5: 123,762,598 I253N probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mta3 A G 17: 83,762,914 D16G probably benign Het
Nlrp4f C A 13: 65,183,065 C838F probably benign Het
Olfr259 T A 2: 87,107,655 H244L probably damaging Het
Pou4f3 A G 18: 42,395,922 K310R probably damaging Het
Reln C A 5: 22,034,584 C895F probably damaging Het
Rnasel A G 1: 153,754,796 T353A probably benign Het
Rpusd4 T C 9: 35,275,128 L320P probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Ssfa2 T G 2: 79,644,831 L378R probably damaging Het
Stbd1 A G 5: 92,605,280 R210G probably benign Het
Sult6b1 G T 17: 78,906,862 T6N probably damaging Het
Tas1r2 G A 4: 139,660,052 R245H probably benign Het
Tpo G A 12: 30,092,586 P713L probably damaging Het
Trim68 G T 7: 102,678,451 H432N probably benign Het
Ttn T C 2: 76,739,141 Q18809R probably damaging Het
Xcr1 A G 9: 123,856,088 I203T possibly damaging Het
Zfp407 T A 18: 84,343,007 T1721S possibly damaging Het
Other mutations in Gm11273
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1980:Gm11273 UTSW 13 21501124 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- GATGCAGCCCACTATTCTCTTG -3'
(R):5'- ATAATTTGAGTGCACTGGGCC -3'

Sequencing Primer
(F):5'- CACTATTCTCTTGTTGCTGATGG -3'
(R):5'- ACTCACAGAGGTATGCTTGC -3'
Posted On2015-06-12