Incidental Mutation 'R4107:Nlrp4f'
ID321435
Institutional Source Beutler Lab
Gene Symbol Nlrp4f
Ensembl Gene ENSMUSG00000032999
Gene NameNLR family, pyrin domain containing 4F
SynonymsNalp-kappa, Nalp4f, C330026N02Rik
MMRRC Submission 040986-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R4107 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location65177111-65205977 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 65183065 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 838 (C838F)
Ref Sequence ENSEMBL: ENSMUSP00000152151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037372] [ENSMUST00000220448] [ENSMUST00000221280] [ENSMUST00000221659] [ENSMUST00000222514]
Predicted Effect probably benign
Transcript: ENSMUST00000037372
AA Change: C838F

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000041908
Gene: ENSMUSG00000032999
AA Change: C838F

DomainStartEndE-ValueType
PYRIN 6 88 1.44e-26 SMART
Pfam:NACHT 147 316 3.4e-39 PFAM
LRR 632 659 1.18e1 SMART
LRR 686 713 4.22e1 SMART
LRR 715 742 5.66e1 SMART
LRR 743 769 4.03e0 SMART
LRR 771 798 1.17e0 SMART
LRR 799 826 1.43e-1 SMART
LRR 828 855 1.03e-2 SMART
LRR 856 883 5.59e-4 SMART
LRR 885 912 2.91e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220448
Predicted Effect probably benign
Transcript: ENSMUST00000221280
Predicted Effect probably benign
Transcript: ENSMUST00000221659
AA Change: C838F

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect silent
Transcript: ENSMUST00000222514
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 G T 5: 121,631,464 S643Y probably damaging Het
Acox3 T C 5: 35,601,552 F369S probably damaging Het
Arhgap31 A G 16: 38,602,426 S1093P probably damaging Het
Armc3 G A 2: 19,288,909 V504M probably benign Het
Ccdc39 A G 3: 33,825,479 L480P probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp2j7 T C 4: 96,199,450 T408A possibly damaging Het
Eml5 T C 12: 98,841,548 probably null Het
Enc1 C A 13: 97,245,138 A52E probably damaging Het
Fhod1 T C 8: 105,338,038 probably benign Het
Gm11273 T C 13: 21,501,337 T28A probably benign Het
Kmt2c A G 5: 25,298,920 S3797P possibly damaging Het
Kntc1 T A 5: 123,762,598 I253N probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mta3 A G 17: 83,762,914 D16G probably benign Het
Olfr259 T A 2: 87,107,655 H244L probably damaging Het
Pou4f3 A G 18: 42,395,922 K310R probably damaging Het
Reln C A 5: 22,034,584 C895F probably damaging Het
Rnasel A G 1: 153,754,796 T353A probably benign Het
Rpusd4 T C 9: 35,275,128 L320P probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Ssfa2 T G 2: 79,644,831 L378R probably damaging Het
Stbd1 A G 5: 92,605,280 R210G probably benign Het
Sult6b1 G T 17: 78,906,862 T6N probably damaging Het
Tas1r2 G A 4: 139,660,052 R245H probably benign Het
Tpo G A 12: 30,092,586 P713L probably damaging Het
Trim68 G T 7: 102,678,451 H432N probably benign Het
Ttn T C 2: 76,739,141 Q18809R probably damaging Het
Xcr1 A G 9: 123,856,088 I203T possibly damaging Het
Zfp407 T A 18: 84,343,007 T1721S possibly damaging Het
Other mutations in Nlrp4f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01608:Nlrp4f APN 13 65195543 nonsense probably null
IGL01676:Nlrp4f APN 13 65195119 missense possibly damaging 0.95
IGL01701:Nlrp4f APN 13 65199409 missense probably damaging 1.00
IGL01799:Nlrp4f APN 13 65187462 missense probably benign 0.03
IGL02084:Nlrp4f APN 13 65194171 nonsense probably null
IGL02234:Nlrp4f APN 13 65194488 missense probably damaging 1.00
IGL02481:Nlrp4f APN 13 65194734 missense probably benign 0.04
IGL02483:Nlrp4f APN 13 65194734 missense probably benign 0.04
IGL02625:Nlrp4f APN 13 65199271 missense probably damaging 1.00
IGL02814:Nlrp4f APN 13 65185042 missense probably damaging 0.98
IGL03077:Nlrp4f APN 13 65194598 missense probably benign 0.10
IGL03111:Nlrp4f APN 13 65183002 missense probably damaging 1.00
IGL03175:Nlrp4f APN 13 65194596 missense probably damaging 1.00
IGL03324:Nlrp4f APN 13 65195228 missense possibly damaging 0.91
R0398:Nlrp4f UTSW 13 65194918 missense possibly damaging 0.79
R0477:Nlrp4f UTSW 13 65190906 missense probably benign 0.01
R0707:Nlrp4f UTSW 13 65194503 missense probably benign 0.42
R1052:Nlrp4f UTSW 13 65185083 missense possibly damaging 0.73
R1302:Nlrp4f UTSW 13 65194557 missense possibly damaging 0.77
R1460:Nlrp4f UTSW 13 65190268 missense probably benign 0.23
R1970:Nlrp4f UTSW 13 65194091 missense probably damaging 1.00
R2111:Nlrp4f UTSW 13 65199353 missense probably benign 0.11
R2272:Nlrp4f UTSW 13 65194408 missense probably benign 0.01
R2370:Nlrp4f UTSW 13 65190846 missense probably damaging 0.99
R2680:Nlrp4f UTSW 13 65194343 nonsense probably null
R3120:Nlrp4f UTSW 13 65194716 missense probably benign 0.13
R3737:Nlrp4f UTSW 13 65194007 missense probably benign 0.01
R4035:Nlrp4f UTSW 13 65194007 missense probably benign 0.01
R4422:Nlrp4f UTSW 13 65184962 critical splice donor site probably null
R4718:Nlrp4f UTSW 13 65194989 missense probably benign 0.01
R5652:Nlrp4f UTSW 13 65182989 missense probably benign 0.00
R5656:Nlrp4f UTSW 13 65190871 nonsense probably null
R5912:Nlrp4f UTSW 13 65194908 missense probably damaging 0.99
R5915:Nlrp4f UTSW 13 65187555 missense probably damaging 1.00
R5955:Nlrp4f UTSW 13 65195081 missense probably benign 0.15
R6683:Nlrp4f UTSW 13 65199195 missense probably benign 0.01
R6742:Nlrp4f UTSW 13 65187440 critical splice donor site probably null
R6750:Nlrp4f UTSW 13 65181654 nonsense probably null
R6751:Nlrp4f UTSW 13 65194429 missense probably damaging 0.99
R7110:Nlrp4f UTSW 13 65199346 missense probably damaging 0.96
R7143:Nlrp4f UTSW 13 65195306 missense probably damaging 1.00
R7143:Nlrp4f UTSW 13 65199352 missense possibly damaging 0.90
R7187:Nlrp4f UTSW 13 65195387 missense possibly damaging 0.47
R7230:Nlrp4f UTSW 13 65194901 missense probably benign 0.16
R7283:Nlrp4f UTSW 13 65195538 nonsense probably null
R7501:Nlrp4f UTSW 13 65194329 missense probably damaging 0.99
R7863:Nlrp4f UTSW 13 65194245 missense possibly damaging 0.63
R7889:Nlrp4f UTSW 13 65195018 missense probably damaging 1.00
Z1088:Nlrp4f UTSW 13 65194302 missense probably benign 0.00
Z1177:Nlrp4f UTSW 13 65194661 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTTGATGACACTCACTGTAG -3'
(R):5'- AGTCCATTTCTGTATGAGCTACC -3'

Sequencing Primer
(F):5'- CTCACTGTAGATCCTTTAAGTGGCAG -3'
(R):5'- CGTCTTCTGCAGGAAAAGTGTACTC -3'
Posted On2015-06-12