Incidental Mutation 'R4107:Arhgap31'
ID321439
Institutional Source Beutler Lab
Gene Symbol Arhgap31
Ensembl Gene ENSMUSG00000022799
Gene NameRho GTPase activating protein 31
SynonymsCdGAP
MMRRC Submission 040986-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R4107 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location38598340-38713274 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38602426 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1093 (S1093P)
Ref Sequence ENSEMBL: ENSMUSP00000023487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023487]
Predicted Effect probably damaging
Transcript: ENSMUST00000023487
AA Change: S1093P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023487
Gene: ENSMUSG00000022799
AA Change: S1093P

DomainStartEndE-ValueType
RhoGAP 32 213 1.04e-60 SMART
low complexity region 291 303 N/A INTRINSIC
low complexity region 503 522 N/A INTRINSIC
low complexity region 670 683 N/A INTRINSIC
low complexity region 722 733 N/A INTRINSIC
low complexity region 766 786 N/A INTRINSIC
Meta Mutation Damage Score 0.1291 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase-activating protein (GAP). A variety of cellular processes are regulated by Rho GTPases which cycle between an inactive form bound to GDP and an active form bound to GTP. This cycling between inactive and active forms is regulated by guanine nucleotide exchange factors and GAPs. The encoded protein is a GAP shown to regulate two GTPases involved in protein trafficking and cell growth. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 G T 5: 121,631,464 S643Y probably damaging Het
Acox3 T C 5: 35,601,552 F369S probably damaging Het
Armc3 G A 2: 19,288,909 V504M probably benign Het
Ccdc39 A G 3: 33,825,479 L480P probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp2j7 T C 4: 96,199,450 T408A possibly damaging Het
Eml5 T C 12: 98,841,548 probably null Het
Enc1 C A 13: 97,245,138 A52E probably damaging Het
Fhod1 T C 8: 105,338,038 probably benign Het
Gm11273 T C 13: 21,501,337 T28A probably benign Het
Kmt2c A G 5: 25,298,920 S3797P possibly damaging Het
Kntc1 T A 5: 123,762,598 I253N probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mta3 A G 17: 83,762,914 D16G probably benign Het
Nlrp4f C A 13: 65,183,065 C838F probably benign Het
Olfr259 T A 2: 87,107,655 H244L probably damaging Het
Pou4f3 A G 18: 42,395,922 K310R probably damaging Het
Reln C A 5: 22,034,584 C895F probably damaging Het
Rnasel A G 1: 153,754,796 T353A probably benign Het
Rpusd4 T C 9: 35,275,128 L320P probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Ssfa2 T G 2: 79,644,831 L378R probably damaging Het
Stbd1 A G 5: 92,605,280 R210G probably benign Het
Sult6b1 G T 17: 78,906,862 T6N probably damaging Het
Tas1r2 G A 4: 139,660,052 R245H probably benign Het
Tpo G A 12: 30,092,586 P713L probably damaging Het
Trim68 G T 7: 102,678,451 H432N probably benign Het
Ttn T C 2: 76,739,141 Q18809R probably damaging Het
Xcr1 A G 9: 123,856,088 I203T possibly damaging Het
Zfp407 T A 18: 84,343,007 T1721S possibly damaging Het
Other mutations in Arhgap31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00741:Arhgap31 APN 16 38603001 missense probably damaging 1.00
IGL01062:Arhgap31 APN 16 38601456 missense probably damaging 1.00
IGL01152:Arhgap31 APN 16 38602239 missense possibly damaging 0.49
IGL01680:Arhgap31 APN 16 38603614 missense probably benign 0.04
IGL01739:Arhgap31 APN 16 38603431 missense probably benign
IGL01870:Arhgap31 APN 16 38618242 missense probably damaging 1.00
IGL01936:Arhgap31 APN 16 38602925 missense probably damaging 1.00
IGL01981:Arhgap31 APN 16 38601573 missense probably damaging 1.00
IGL01983:Arhgap31 APN 16 38601765 missense probably damaging 1.00
IGL02157:Arhgap31 APN 16 38623901 missense probably damaging 1.00
IGL02629:Arhgap31 APN 16 38609164 missense probably benign 0.00
IGL03375:Arhgap31 APN 16 38602828 missense probably damaging 1.00
PIT4283001:Arhgap31 UTSW 16 38608992 missense probably damaging 1.00
R0271:Arhgap31 UTSW 16 38602510 missense possibly damaging 0.61
R1325:Arhgap31 UTSW 16 38602942 missense probably benign 0.00
R1753:Arhgap31 UTSW 16 38601612 missense possibly damaging 0.92
R1766:Arhgap31 UTSW 16 38625590 missense probably damaging 1.00
R1834:Arhgap31 UTSW 16 38603703 missense probably benign 0.02
R2104:Arhgap31 UTSW 16 38625579 missense probably benign 0.03
R2261:Arhgap31 UTSW 16 38609277 missense probably damaging 1.00
R3011:Arhgap31 UTSW 16 38601907 missense possibly damaging 0.58
R3712:Arhgap31 UTSW 16 38602533 missense possibly damaging 0.91
R3757:Arhgap31 UTSW 16 38637000 missense probably damaging 1.00
R3953:Arhgap31 UTSW 16 38603464 missense probably benign 0.00
R4105:Arhgap31 UTSW 16 38602426 missense probably damaging 1.00
R4108:Arhgap31 UTSW 16 38602426 missense probably damaging 1.00
R4109:Arhgap31 UTSW 16 38602426 missense probably damaging 1.00
R4198:Arhgap31 UTSW 16 38623913 missense probably damaging 1.00
R4200:Arhgap31 UTSW 16 38623913 missense probably damaging 1.00
R4273:Arhgap31 UTSW 16 38602335 missense possibly damaging 0.92
R5020:Arhgap31 UTSW 16 38603076 missense probably damaging 1.00
R5100:Arhgap31 UTSW 16 38601459 missense probably damaging 1.00
R6516:Arhgap31 UTSW 16 38609404 missense possibly damaging 0.47
R6879:Arhgap31 UTSW 16 38602314 missense probably benign
R7341:Arhgap31 UTSW 16 38712514 intron probably null
R7880:Arhgap31 UTSW 16 38602725 missense probably benign 0.37
R7884:Arhgap31 UTSW 16 38602231 missense probably damaging 0.97
R7963:Arhgap31 UTSW 16 38602725 missense probably benign 0.37
R7967:Arhgap31 UTSW 16 38602231 missense probably damaging 0.97
R8156:Arhgap31 UTSW 16 38625629 missense probably damaging 1.00
X0063:Arhgap31 UTSW 16 38602398 missense probably damaging 0.99
Z1176:Arhgap31 UTSW 16 38623893 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGACACACTTACAGGAGCCG -3'
(R):5'- CAACTGGAACTTAGCAACCGTC -3'

Sequencing Primer
(F):5'- AACAATGTCCAGGTCCTGCG -3'
(R):5'- GTCAGATGAAACACAGTGATGTTCCC -3'
Posted On2015-06-12