Incidental Mutation 'R4107:Sult6b1'
ID321440
Institutional Source Beutler Lab
Gene Symbol Sult6b1
Ensembl Gene ENSMUSG00000038045
Gene Namesulfotransferase family, cytosolic, 6B, member 1
Synonyms
MMRRC Submission 040986-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R4107 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location78883938-78906992 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 78906862 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 6 (T6N)
Ref Sequence ENSEMBL: ENSMUSP00000124309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042683] [ENSMUST00000159710] [ENSMUST00000169544]
Predicted Effect probably benign
Transcript: ENSMUST00000042683
AA Change: T6N

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000038282
Gene: ENSMUSG00000038045
AA Change: T6N

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 17 252 2.6e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159710
AA Change: T6N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect possibly damaging
Transcript: ENSMUST00000169544
AA Change: T44N

PolyPhen 2 Score 0.602 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000132823
Gene: ENSMUSG00000038045
AA Change: T44N

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 55 290 2.1e-57 PFAM
Meta Mutation Damage Score 0.1028 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 G T 5: 121,631,464 S643Y probably damaging Het
Acox3 T C 5: 35,601,552 F369S probably damaging Het
Arhgap31 A G 16: 38,602,426 S1093P probably damaging Het
Armc3 G A 2: 19,288,909 V504M probably benign Het
Ccdc39 A G 3: 33,825,479 L480P probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp2j7 T C 4: 96,199,450 T408A possibly damaging Het
Eml5 T C 12: 98,841,548 probably null Het
Enc1 C A 13: 97,245,138 A52E probably damaging Het
Fhod1 T C 8: 105,338,038 probably benign Het
Gm11273 T C 13: 21,501,337 T28A probably benign Het
Kmt2c A G 5: 25,298,920 S3797P possibly damaging Het
Kntc1 T A 5: 123,762,598 I253N probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mta3 A G 17: 83,762,914 D16G probably benign Het
Nlrp4f C A 13: 65,183,065 C838F probably benign Het
Olfr259 T A 2: 87,107,655 H244L probably damaging Het
Pou4f3 A G 18: 42,395,922 K310R probably damaging Het
Reln C A 5: 22,034,584 C895F probably damaging Het
Rnasel A G 1: 153,754,796 T353A probably benign Het
Rpusd4 T C 9: 35,275,128 L320P probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Ssfa2 T G 2: 79,644,831 L378R probably damaging Het
Stbd1 A G 5: 92,605,280 R210G probably benign Het
Tas1r2 G A 4: 139,660,052 R245H probably benign Het
Tpo G A 12: 30,092,586 P713L probably damaging Het
Trim68 G T 7: 102,678,451 H432N probably benign Het
Ttn T C 2: 76,739,141 Q18809R probably damaging Het
Xcr1 A G 9: 123,856,088 I203T possibly damaging Het
Zfp407 T A 18: 84,343,007 T1721S possibly damaging Het
Other mutations in Sult6b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01479:Sult6b1 APN 17 78905576 missense probably benign 0.00
IGL02065:Sult6b1 APN 17 78889075 missense probably damaging 0.99
R0522:Sult6b1 UTSW 17 78905529 missense probably damaging 0.97
R1911:Sult6b1 UTSW 17 78888964 missense possibly damaging 0.81
R3546:Sult6b1 UTSW 17 78906907 missense probably benign 0.00
R4105:Sult6b1 UTSW 17 78906862 missense probably damaging 1.00
R4108:Sult6b1 UTSW 17 78906862 missense probably damaging 1.00
R5063:Sult6b1 UTSW 17 78905576 missense probably benign 0.00
R5478:Sult6b1 UTSW 17 78894672 splice site probably null
R5845:Sult6b1 UTSW 17 78894630 missense probably damaging 1.00
R6256:Sult6b1 UTSW 17 78906914 missense probably benign 0.05
R6374:Sult6b1 UTSW 17 78906931 missense probably benign 0.04
R7128:Sult6b1 UTSW 17 78894641 missense probably damaging 1.00
R7357:Sult6b1 UTSW 17 78894630 missense probably damaging 1.00
R7903:Sult6b1 UTSW 17 78890850 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- GACTTTGTAACGCATGCACTC -3'
(R):5'- CAAATAGTCACTCCACCTGGG -3'

Sequencing Primer
(F):5'- GTAACGCATGCACTCTCCTG -3'
(R):5'- GTGACACAGAGTGGACACATTATC -3'
Posted On2015-06-12