Incidental Mutation 'R4107:Mta3'
ID321441
Institutional Source Beutler Lab
Gene Symbol Mta3
Ensembl Gene ENSMUSG00000055817
Gene Namemetastasis associated 3
Synonyms1110002J22Rik
MMRRC Submission 040986-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.607) question?
Stock #R4107 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location83706163-83821516 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83762914 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 16 (D16G)
Ref Sequence ENSEMBL: ENSMUSP00000135752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067826] [ENSMUST00000112349] [ENSMUST00000112350] [ENSMUST00000112352] [ENSMUST00000176816] [ENSMUST00000177069]
Predicted Effect probably benign
Transcript: ENSMUST00000067826
AA Change: D167G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000068931
Gene: ENSMUSG00000055817
AA Change: D167G

DomainStartEndE-ValueType
BAH 4 147 2.62e-30 SMART
ELM2 150 203 3.49e-16 SMART
SANT 266 315 7.94e-8 SMART
ZnF_GATA 371 425 8.33e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112349
AA Change: D168G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107968
Gene: ENSMUSG00000055817
AA Change: D168G

DomainStartEndE-ValueType
BAH 4 147 2.62e-30 SMART
ELM2 150 204 2.5e-17 SMART
SANT 267 316 7.94e-8 SMART
ZnF_GATA 373 427 8.33e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112350
AA Change: D168G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107969
Gene: ENSMUSG00000055817
AA Change: D168G

DomainStartEndE-ValueType
BAH 4 147 2.62e-30 SMART
ELM2 150 204 2.5e-17 SMART
SANT 267 316 7.94e-8 SMART
ZnF_GATA 372 426 8.33e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112352
AA Change: D168G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107971
Gene: ENSMUSG00000055817
AA Change: D168G

DomainStartEndE-ValueType
BAH 4 147 2.62e-30 SMART
ELM2 150 204 2.5e-17 SMART
SANT 267 316 7.94e-8 SMART
ZnF_GATA 372 426 8.33e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176816
AA Change: D16G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000135752
Gene: ENSMUSG00000055817
AA Change: D16G

DomainStartEndE-ValueType
ELM2 1 52 3.23e-11 SMART
SANT 115 164 7.94e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177069
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 G T 5: 121,631,464 S643Y probably damaging Het
Acox3 T C 5: 35,601,552 F369S probably damaging Het
Arhgap31 A G 16: 38,602,426 S1093P probably damaging Het
Armc3 G A 2: 19,288,909 V504M probably benign Het
Ccdc39 A G 3: 33,825,479 L480P probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp2j7 T C 4: 96,199,450 T408A possibly damaging Het
Eml5 T C 12: 98,841,548 probably null Het
Enc1 C A 13: 97,245,138 A52E probably damaging Het
Fhod1 T C 8: 105,338,038 probably benign Het
Gm11273 T C 13: 21,501,337 T28A probably benign Het
Kmt2c A G 5: 25,298,920 S3797P possibly damaging Het
Kntc1 T A 5: 123,762,598 I253N probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Nlrp4f C A 13: 65,183,065 C838F probably benign Het
Olfr259 T A 2: 87,107,655 H244L probably damaging Het
Pou4f3 A G 18: 42,395,922 K310R probably damaging Het
Reln C A 5: 22,034,584 C895F probably damaging Het
Rnasel A G 1: 153,754,796 T353A probably benign Het
Rpusd4 T C 9: 35,275,128 L320P probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Ssfa2 T G 2: 79,644,831 L378R probably damaging Het
Stbd1 A G 5: 92,605,280 R210G probably benign Het
Sult6b1 G T 17: 78,906,862 T6N probably damaging Het
Tas1r2 G A 4: 139,660,052 R245H probably benign Het
Tpo G A 12: 30,092,586 P713L probably damaging Het
Trim68 G T 7: 102,678,451 H432N probably benign Het
Ttn T C 2: 76,739,141 Q18809R probably damaging Het
Xcr1 A G 9: 123,856,088 I203T possibly damaging Het
Zfp407 T A 18: 84,343,007 T1721S possibly damaging Het
Other mutations in Mta3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Mta3 APN 17 83708432 missense probably damaging 1.00
IGL00467:Mta3 APN 17 83755684 splice site probably benign
IGL00475:Mta3 APN 17 83708432 missense probably damaging 1.00
IGL00539:Mta3 APN 17 83762983 missense probably benign 0.25
IGL01722:Mta3 APN 17 83755643 missense possibly damaging 0.95
IGL03355:Mta3 APN 17 83800045 splice site probably benign
container UTSW 17 83708446 missense probably damaging 1.00
R0440:Mta3 UTSW 17 83766587 missense probably damaging 1.00
R0630:Mta3 UTSW 17 83714627 missense probably damaging 0.98
R1848:Mta3 UTSW 17 83755551 splice site probably benign
R1870:Mta3 UTSW 17 83781968 missense probably damaging 0.98
R2358:Mta3 UTSW 17 83762988 missense probably damaging 0.96
R2373:Mta3 UTSW 17 83784301 nonsense probably null
R2447:Mta3 UTSW 17 83804544 missense probably benign 0.03
R3711:Mta3 UTSW 17 83762988 missense probably damaging 0.96
R3712:Mta3 UTSW 17 83762988 missense probably damaging 0.96
R4771:Mta3 UTSW 17 83755674 missense probably damaging 0.98
R5259:Mta3 UTSW 17 83804574 missense probably damaging 1.00
R5980:Mta3 UTSW 17 83708405 missense probably damaging 1.00
R6175:Mta3 UTSW 17 83791793 missense probably benign
R6555:Mta3 UTSW 17 83708446 missense probably damaging 1.00
R6909:Mta3 UTSW 17 83766551 missense possibly damaging 0.92
R7170:Mta3 UTSW 17 83714662 missense probably damaging 1.00
R7350:Mta3 UTSW 17 83708441 missense probably damaging 1.00
R7597:Mta3 UTSW 17 83775582 missense probably benign 0.05
R7638:Mta3 UTSW 17 83800143 missense probably benign
R7747:Mta3 UTSW 17 83791736 nonsense probably null
Z1088:Mta3 UTSW 17 83762914 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTGTGCTACAGTGTCAGTAACC -3'
(R):5'- GGCATTAGCAGTGAGACACAC -3'

Sequencing Primer
(F):5'- TGCTACAGTGTCAGTAACCACATAAC -3'
(R):5'- TTCTGGTCTCCAAAAGCAACTGG -3'
Posted On2015-06-12