Incidental Mutation 'R4107:Pou4f3'
ID321442
Institutional Source Beutler Lab
Gene Symbol Pou4f3
Ensembl Gene ENSMUSG00000024497
Gene NamePOU domain, class 4, transcription factor 3
SynonymsBrn3c, Brn-3.1, Brn3.1
MMRRC Submission 040986-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.741) question?
Stock #R4107 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location42394539-42397249 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42395922 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 310 (K310R)
Ref Sequence ENSEMBL: ENSMUSP00000025374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025374]
Predicted Effect probably damaging
Transcript: ENSMUST00000025374
AA Change: K310R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000025374
Gene: ENSMUSG00000024497
AA Change: K310R

DomainStartEndE-ValueType
low complexity region 53 62 N/A INTRINSIC
low complexity region 84 98 N/A INTRINSIC
POU 179 256 4.97e-51 SMART
HOX 274 336 5.76e-18 SMART
Meta Mutation Damage Score 0.1355 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the POU-domain family of transcription factors. POU-domain proteins have been observed to play important roles in control of cell identity in several systems. This protein is found in the retina and may play a role in determining or maintaining the identities of a small subset of visual system neurons. Defects in this gene are the cause of non-syndromic sensorineural deafness autosomal dominant type 15. [provided by RefSeq, Mar 2009]
PHENOTYPE: Affected mice are slightly smaller than their littermates and exhibit vertical head-tossing, circling and general hyperactive behavior typical of the shaker-waltzer class of mutants. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 G T 5: 121,631,464 S643Y probably damaging Het
Acox3 T C 5: 35,601,552 F369S probably damaging Het
Arhgap31 A G 16: 38,602,426 S1093P probably damaging Het
Armc3 G A 2: 19,288,909 V504M probably benign Het
Ccdc39 A G 3: 33,825,479 L480P probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp2j7 T C 4: 96,199,450 T408A possibly damaging Het
Eml5 T C 12: 98,841,548 probably null Het
Enc1 C A 13: 97,245,138 A52E probably damaging Het
Fhod1 T C 8: 105,338,038 probably benign Het
Gm11273 T C 13: 21,501,337 T28A probably benign Het
Kmt2c A G 5: 25,298,920 S3797P possibly damaging Het
Kntc1 T A 5: 123,762,598 I253N probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mta3 A G 17: 83,762,914 D16G probably benign Het
Nlrp4f C A 13: 65,183,065 C838F probably benign Het
Olfr259 T A 2: 87,107,655 H244L probably damaging Het
Reln C A 5: 22,034,584 C895F probably damaging Het
Rnasel A G 1: 153,754,796 T353A probably benign Het
Rpusd4 T C 9: 35,275,128 L320P probably damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Ssfa2 T G 2: 79,644,831 L378R probably damaging Het
Stbd1 A G 5: 92,605,280 R210G probably benign Het
Sult6b1 G T 17: 78,906,862 T6N probably damaging Het
Tas1r2 G A 4: 139,660,052 R245H probably benign Het
Tpo G A 12: 30,092,586 P713L probably damaging Het
Trim68 G T 7: 102,678,451 H432N probably benign Het
Ttn T C 2: 76,739,141 Q18809R probably damaging Het
Xcr1 A G 9: 123,856,088 I203T possibly damaging Het
Zfp407 T A 18: 84,343,007 T1721S possibly damaging Het
Other mutations in Pou4f3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Pou4f3 APN 18 42395966 nonsense probably null
PIT4472001:Pou4f3 UTSW 18 42394652 missense probably benign 0.30
R2899:Pou4f3 UTSW 18 42395523 missense probably benign 0.00
R4108:Pou4f3 UTSW 18 42395922 missense probably damaging 1.00
R4799:Pou4f3 UTSW 18 42395987 missense possibly damaging 0.46
R5084:Pou4f3 UTSW 18 42395868 missense probably damaging 0.99
R5366:Pou4f3 UTSW 18 42395754 missense probably damaging 0.99
R5560:Pou4f3 UTSW 18 42395415 missense probably benign 0.00
R6624:Pou4f3 UTSW 18 42395642 missense probably damaging 0.99
R7492:Pou4f3 UTSW 18 42395931 missense probably damaging 1.00
R7816:Pou4f3 UTSW 18 42395186 missense probably benign 0.03
R8460:Pou4f3 UTSW 18 42395988 missense probably damaging 0.97
Z1177:Pou4f3 UTSW 18 42395909 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TACTCTGTCGCACAACAACATG -3'
(R):5'- AGGAAACACCCTGGAGTGTC -3'

Sequencing Primer
(F):5'- ATGATCGCTCTCAAGCCG -3'
(R):5'- TGGAGTGTCCCGTAACGTC -3'
Posted On2015-06-12