Incidental Mutation 'R4108:Setd1a'
ID 321473
Institutional Source Beutler Lab
Gene Symbol Setd1a
Ensembl Gene ENSMUSG00000042308
Gene Name SET domain containing 1A
Synonyms KMT2F
MMRRC Submission 040987-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4108 (G1)
Quality Score 198
Status Validated
Chromosome 7
Chromosomal Location 127376561-127399294 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) G to A at 127398374 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046863] [ENSMUST00000047075] [ENSMUST00000047157] [ENSMUST00000106267] [ENSMUST00000106271] [ENSMUST00000106272] [ENSMUST00000154987] [ENSMUST00000155005] [ENSMUST00000125188] [ENSMUST00000206674] [ENSMUST00000138432] [ENSMUST00000139068]
AlphaFold E9PYH6
Predicted Effect probably benign
Transcript: ENSMUST00000046863
SMART Domains Protein: ENSMUSP00000036245
Gene: ENSMUSG00000042289

DomainStartEndE-ValueType
Pfam:KR 11 147 3e-10 PFAM
Pfam:RmlD_sub_bind 11 198 8.1e-10 PFAM
Pfam:Polysacc_synt_2 12 140 4.6e-13 PFAM
Pfam:NmrA 12 142 1.9e-9 PFAM
Pfam:Epimerase 12 215 3.2e-25 PFAM
Pfam:GDP_Man_Dehyd 13 185 8.1e-17 PFAM
Pfam:3Beta_HSD 13 290 5.4e-99 PFAM
Pfam:NAD_binding_4 14 240 1.4e-15 PFAM
transmembrane domain 312 334 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000047075
AA Change: A1651T
SMART Domains Protein: ENSMUSP00000047672
Gene: ENSMUSG00000042308
AA Change: A1651T

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000047157
AA Change: A1651T
SMART Domains Protein: ENSMUSP00000037600
Gene: ENSMUSG00000042308
AA Change: A1651T

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106267
SMART Domains Protein: ENSMUSP00000101874
Gene: ENSMUSG00000030806

DomainStartEndE-ValueType
SynN 24 145 1.99e-44 SMART
t_SNARE 186 253 4.32e-24 SMART
transmembrane domain 265 287 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106271
SMART Domains Protein: ENSMUSP00000101878
Gene: ENSMUSG00000042289

DomainStartEndE-ValueType
Pfam:adh_short 10 143 1.3e-13 PFAM
Pfam:RmlD_sub_bind 10 186 3.7e-10 PFAM
Pfam:KR 11 140 5.7e-10 PFAM
Pfam:Polysacc_synt_2 12 140 2.8e-13 PFAM
Pfam:NmrA 12 141 2.7e-9 PFAM
Pfam:Epimerase 12 220 2.9e-26 PFAM
Pfam:NAD_binding_10 13 186 2.3e-11 PFAM
Pfam:3Beta_HSD 13 216 1e-70 PFAM
Pfam:NAD_binding_4 14 183 1.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106272
SMART Domains Protein: ENSMUSP00000101879
Gene: ENSMUSG00000042289

DomainStartEndE-ValueType
Pfam:adh_short 10 143 3.7e-13 PFAM
Pfam:RmlD_sub_bind 10 180 2.8e-9 PFAM
Pfam:KR 11 139 1.6e-9 PFAM
Pfam:Polysacc_synt_2 12 140 7.7e-13 PFAM
Pfam:NmrA 12 141 7.3e-9 PFAM
Pfam:Epimerase 12 215 7.1e-26 PFAM
Pfam:NAD_binding_10 13 179 1.1e-10 PFAM
Pfam:3Beta_HSD 13 188 6.1e-70 PFAM
Pfam:NAD_binding_4 14 187 1.5e-17 PFAM
Pfam:3Beta_HSD 177 261 4e-23 PFAM
transmembrane domain 281 303 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000154987
AA Change: A1108T
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144748
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124631
Predicted Effect probably benign
Transcript: ENSMUST00000155005
Predicted Effect probably benign
Transcript: ENSMUST00000125188
Predicted Effect probably benign
Transcript: ENSMUST00000136823
Predicted Effect probably benign
Transcript: ENSMUST00000206674
Predicted Effect probably benign
Transcript: ENSMUST00000138432
SMART Domains Protein: ENSMUSP00000114536
Gene: ENSMUSG00000042289

DomainStartEndE-ValueType
Pfam:3Beta_HSD 18 78 1.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139068
SMART Domains Protein: ENSMUSP00000121246
Gene: ENSMUSG00000042289

DomainStartEndE-ValueType
Pfam:3Beta_HSD 13 55 2.7e-13 PFAM
Pfam:3Beta_HSD 53 100 3.2e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206995
Meta Mutation Damage Score 0.7291 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a histone methyltransferase (HMT) complex that produces mono-, di-, and trimethylated histone H3 at Lys4. Trimethylation of histone H3 at lysine 4 (H3K4me3) is a chromatin modification known to generally mark the transcription start sites of active genes. The protein contains SET domains, a RNA recognition motif domain and is a member of the class V-like SAM-binding methyltransferase superfamily. [provided by RefSeq, Dec 2016]
PHENOTYPE: Animals homozygous for this allele were dead by E7.5 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik A G 10: 87,061,796 (GRCm39) Y82C probably damaging Het
4930579F01Rik T C 3: 137,889,431 (GRCm39) N62S probably benign Het
Acad10 G T 5: 121,769,527 (GRCm39) S643Y probably damaging Het
Acox3 T C 5: 35,758,896 (GRCm39) F369S probably damaging Het
Arhgap31 A G 16: 38,422,788 (GRCm39) S1093P probably damaging Het
Atp4b A G 8: 13,446,640 (GRCm39) probably null Het
Bmper G A 9: 23,136,059 (GRCm39) V47I probably benign Het
Caskin1 C A 17: 24,721,121 (GRCm39) T487K probably benign Het
Ccr7 C T 11: 99,036,204 (GRCm39) M239I probably damaging Het
Cdh23 C A 10: 60,246,601 (GRCm39) V944L possibly damaging Het
Cenpf A G 1: 189,416,065 (GRCm39) S87P probably damaging Het
Chd9 A T 8: 91,737,304 (GRCm39) D1461V probably benign Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Cyb5r2 A T 7: 107,353,136 (GRCm39) M102K probably damaging Het
Cyp2j7 T C 4: 96,087,687 (GRCm39) T408A possibly damaging Het
Dnajb2 G T 1: 75,213,543 (GRCm39) E6* probably null Het
Dtx4 G A 19: 12,478,487 (GRCm39) A32V probably damaging Het
Eml5 T C 12: 98,807,807 (GRCm39) probably null Het
Eml6 A C 11: 29,755,136 (GRCm39) S880A probably damaging Het
Fsd2 C T 7: 81,194,715 (GRCm39) V483I probably benign Het
Inf2 T C 12: 112,574,015 (GRCm39) L773P unknown Het
Kif26b A G 1: 178,744,530 (GRCm39) Q1095R possibly damaging Het
Leprotl1 A G 8: 34,607,913 (GRCm39) probably null Het
Lrp1b A G 2: 40,555,099 (GRCm39) V340A unknown Het
Myh1 T C 11: 67,102,403 (GRCm39) V898A probably benign Het
Ncstn G T 1: 171,900,111 (GRCm39) N254K probably damaging Het
Nfatc1 T A 18: 80,741,583 (GRCm39) H139L possibly damaging Het
Nfe2l1 C T 11: 96,710,220 (GRCm39) probably null Het
Nfya G T 17: 48,699,912 (GRCm39) Y37* probably null Het
Obscn T C 11: 59,022,472 (GRCm39) R758G possibly damaging Het
Or2b6 A G 13: 21,822,952 (GRCm39) V247A probably damaging Het
Or7g26 T A 9: 19,230,608 (GRCm39) Y265* probably null Het
Otogl C T 10: 107,607,105 (GRCm39) V2093I probably benign Het
Phc2 A G 4: 128,601,776 (GRCm39) Y77C probably damaging Het
Pik3c2g C A 6: 139,676,096 (GRCm39) A80E probably benign Het
Plxnd1 G T 6: 115,936,276 (GRCm39) H1675N probably damaging Het
Pou4f3 A G 18: 42,528,987 (GRCm39) K310R probably damaging Het
Ppp1r12c T C 7: 4,489,565 (GRCm39) D199G probably damaging Het
Prss22 A G 17: 24,212,847 (GRCm39) Y297H probably benign Het
Psmb7 T A 2: 38,532,211 (GRCm39) H78L probably damaging Het
Rad51ap2 T C 12: 11,508,396 (GRCm39) C773R probably damaging Het
Rpl12 A T 2: 32,851,836 (GRCm39) N8Y probably damaging Het
Ryr3 C G 2: 112,506,218 (GRCm39) R3443P probably damaging Het
Sbf1 T C 15: 89,172,788 (GRCm39) probably benign Het
Scn3a A G 2: 65,325,379 (GRCm39) I1046T probably benign Het
Slc15a2 G T 16: 36,602,755 (GRCm39) probably benign Het
Slc34a2 G A 5: 53,221,351 (GRCm39) V266I possibly damaging Het
Smtn G A 11: 3,476,449 (GRCm39) T144I probably benign Het
Spta1 A G 1: 174,002,122 (GRCm39) N84S probably benign Het
Sult6b1 G T 17: 79,214,291 (GRCm39) T6N probably damaging Het
Supt16 T C 14: 52,400,188 (GRCm39) E985G probably damaging Het
Tbcd T A 11: 121,384,637 (GRCm39) H39Q probably benign Het
Tpo G A 12: 30,142,585 (GRCm39) P713L probably damaging Het
Tsg101 T A 7: 46,542,242 (GRCm39) D99V probably damaging Het
Ttn G C 2: 76,581,215 (GRCm39) A23226G probably damaging Het
Ttn C T 2: 76,608,809 (GRCm39) V15990I probably benign Het
Ubald1 C A 16: 4,693,731 (GRCm39) M61I probably benign Het
Ush1c C T 7: 45,847,869 (GRCm39) D465N probably damaging Het
Vmn2r129 G T 4: 156,686,692 (GRCm39) noncoding transcript Het
Vps54 A G 11: 21,262,877 (GRCm39) I655V probably benign Het
Other mutations in Setd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02508:Setd1a APN 7 127,396,870 (GRCm39) unclassified probably benign
IGL02657:Setd1a APN 7 127,394,997 (GRCm39) unclassified probably benign
IGL02792:Setd1a APN 7 127,390,522 (GRCm39) missense unknown
IGL02876:Setd1a APN 7 127,377,673 (GRCm39) splice site probably benign
IGL02967:Setd1a APN 7 127,384,349 (GRCm39) unclassified probably benign
IGL03090:Setd1a APN 7 127,385,672 (GRCm39) missense possibly damaging 0.83
IGL03238:Setd1a APN 7 127,384,718 (GRCm39) missense possibly damaging 0.86
FR4449:Setd1a UTSW 7 127,384,498 (GRCm39) unclassified probably benign
FR4548:Setd1a UTSW 7 127,384,485 (GRCm39) unclassified probably benign
FR4548:Setd1a UTSW 7 127,384,479 (GRCm39) unclassified probably benign
FR4589:Setd1a UTSW 7 127,384,469 (GRCm39) unclassified probably benign
FR4737:Setd1a UTSW 7 127,384,484 (GRCm39) unclassified probably benign
FR4976:Setd1a UTSW 7 127,384,488 (GRCm39) unclassified probably benign
FR4976:Setd1a UTSW 7 127,384,479 (GRCm39) unclassified probably benign
R0367:Setd1a UTSW 7 127,387,358 (GRCm39) splice site probably benign
R0411:Setd1a UTSW 7 127,395,223 (GRCm39) unclassified probably benign
R0416:Setd1a UTSW 7 127,384,469 (GRCm39) unclassified probably benign
R0470:Setd1a UTSW 7 127,384,229 (GRCm39) unclassified probably benign
R0645:Setd1a UTSW 7 127,386,382 (GRCm39) missense probably damaging 0.96
R0667:Setd1a UTSW 7 127,385,765 (GRCm39) missense probably damaging 0.99
R1251:Setd1a UTSW 7 127,396,596 (GRCm39) unclassified probably benign
R1465:Setd1a UTSW 7 127,387,512 (GRCm39) unclassified probably benign
R1465:Setd1a UTSW 7 127,387,512 (GRCm39) unclassified probably benign
R1660:Setd1a UTSW 7 127,395,841 (GRCm39) unclassified probably benign
R1730:Setd1a UTSW 7 127,384,296 (GRCm39) nonsense probably null
R1760:Setd1a UTSW 7 127,385,062 (GRCm39) missense possibly damaging 0.68
R1783:Setd1a UTSW 7 127,384,296 (GRCm39) nonsense probably null
R2149:Setd1a UTSW 7 127,385,690 (GRCm39) missense possibly damaging 0.75
R2159:Setd1a UTSW 7 127,384,661 (GRCm39) missense possibly damaging 0.91
R2303:Setd1a UTSW 7 127,398,327 (GRCm39) unclassified probably benign
R2679:Setd1a UTSW 7 127,394,896 (GRCm39) unclassified probably benign
R3428:Setd1a UTSW 7 127,384,493 (GRCm39) unclassified probably benign
R4227:Setd1a UTSW 7 127,395,819 (GRCm39) unclassified probably benign
R4438:Setd1a UTSW 7 127,384,903 (GRCm39) missense possibly damaging 0.83
R4730:Setd1a UTSW 7 127,396,502 (GRCm39) unclassified probably benign
R4869:Setd1a UTSW 7 127,396,776 (GRCm39) unclassified probably benign
R4892:Setd1a UTSW 7 127,377,696 (GRCm39) missense probably damaging 0.99
R5152:Setd1a UTSW 7 127,383,197 (GRCm39) missense probably benign
R5502:Setd1a UTSW 7 127,396,420 (GRCm39) critical splice donor site probably null
R5527:Setd1a UTSW 7 127,384,801 (GRCm39) missense probably damaging 0.99
R6189:Setd1a UTSW 7 127,377,455 (GRCm39) splice site probably null
R6250:Setd1a UTSW 7 127,390,471 (GRCm39) missense unknown
R7131:Setd1a UTSW 7 127,395,590 (GRCm39) small deletion probably benign
R7988:Setd1a UTSW 7 127,385,366 (GRCm39) missense probably benign 0.02
R8029:Setd1a UTSW 7 127,385,386 (GRCm39) missense probably benign 0.08
R8079:Setd1a UTSW 7 127,384,225 (GRCm39) missense unknown
R8171:Setd1a UTSW 7 127,390,399 (GRCm39) missense unknown
R8175:Setd1a UTSW 7 127,395,415 (GRCm39) missense unknown
R8286:Setd1a UTSW 7 127,385,356 (GRCm39) missense possibly damaging 0.96
R8327:Setd1a UTSW 7 127,390,669 (GRCm39) missense unknown
R8460:Setd1a UTSW 7 127,383,292 (GRCm39) missense unknown
R8547:Setd1a UTSW 7 127,395,676 (GRCm39) unclassified probably benign
R8699:Setd1a UTSW 7 127,385,774 (GRCm39) missense possibly damaging 0.53
R8822:Setd1a UTSW 7 127,385,332 (GRCm39) missense possibly damaging 0.86
R8968:Setd1a UTSW 7 127,385,279 (GRCm39) missense possibly damaging 0.93
R9063:Setd1a UTSW 7 127,385,558 (GRCm39) missense possibly damaging 0.91
R9178:Setd1a UTSW 7 127,385,590 (GRCm39) missense possibly damaging 0.93
R9672:Setd1a UTSW 7 127,385,237 (GRCm39) missense possibly damaging 0.96
R9700:Setd1a UTSW 7 127,385,752 (GRCm39) missense possibly damaging 0.53
RF001:Setd1a UTSW 7 127,384,486 (GRCm39) unclassified probably benign
RF008:Setd1a UTSW 7 127,384,486 (GRCm39) unclassified probably benign
RF011:Setd1a UTSW 7 127,384,515 (GRCm39) unclassified probably benign
RF014:Setd1a UTSW 7 127,384,518 (GRCm39) unclassified probably benign
RF030:Setd1a UTSW 7 127,384,483 (GRCm39) unclassified probably benign
RF030:Setd1a UTSW 7 127,384,473 (GRCm39) unclassified probably benign
RF031:Setd1a UTSW 7 127,384,483 (GRCm39) unclassified probably benign
RF036:Setd1a UTSW 7 127,384,472 (GRCm39) unclassified probably benign
RF041:Setd1a UTSW 7 127,384,504 (GRCm39) unclassified probably benign
RF052:Setd1a UTSW 7 127,384,529 (GRCm39) unclassified probably benign
RF055:Setd1a UTSW 7 127,384,471 (GRCm39) unclassified probably benign
RF056:Setd1a UTSW 7 127,384,500 (GRCm39) unclassified probably benign
RF056:Setd1a UTSW 7 127,384,475 (GRCm39) unclassified probably benign
RF058:Setd1a UTSW 7 127,384,490 (GRCm39) unclassified probably benign
Z1176:Setd1a UTSW 7 127,398,266 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GAGCAGGTACACTCAGATGC -3'
(R):5'- GGCTGCTTCGAGTAGATGAC -3'

Sequencing Primer
(F):5'- GGTACACTCAGATGCCGACC -3'
(R):5'- CAATCTTTTTCTGAGACTCAATGGTG -3'
Posted On 2015-06-12