Mutagenetix > Incidental Mutations

Incidental Mutation 'R4108:Dtx4'

321507

Institutional Source

Beutler Lab

Gene Symbol

Dtx4

Ensembl Gene

ENSMUSG00000039982

Gene Name

deltex 4, E3 ubiquitin ligase

Synonyms

RNF155

MMRRC Submission

040987-MU

Accession Numbers

Genbank: NM_001047855

Is this an essential gene?

Possibly non essential (E-score: 0.481) question?

Stock #

R4108 (G1)

Quality Score

102

Status

Validated

Chromosome

Chromosomal Location

12466341-12501996 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 12501123 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 32 (A32V)

Ref Sequence

ENSEMBL: ENSMUSP00000040229 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045521]

AlphaFold

Q6PDK8

Predicted Effect

probably damaging
Transcript: ENSMUST00000045521
AA Change: A32V

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000040229
Gene: ENSMUSG00000039982
AA Change: A32V

Domain	Start	End	E-Value	Type
WWE	5	86	1.38e-38	SMART
WWE	88	163	6.72e-28	SMART
low complexity region	175	192	N/A	INTRINSIC
low complexity region	372	386	N/A	INTRINSIC
RING	406	464	2.2e-6	SMART
Blast:RING	510	532	3e-7	BLAST

Meta Mutation Damage Score

0.1203

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

97% (65/67)

Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700113H08Rik	A	G	10: 87,225,934	Y82C	probably damaging	Het
4930579F01Rik	T	C	3: 138,183,670	N62S	probably benign	Het
Acad10	G	T	5: 121,631,464	S643Y	probably damaging	Het
Acox3	T	C	5: 35,601,552	F369S	probably damaging	Het
Arhgap31	A	G	16: 38,602,426	S1093P	probably damaging	Het
Atp4b	A	G	8: 13,396,640		probably null	Het
Bmper	G	A	9: 23,224,763	V47I	probably benign	Het
Caskin1	C	A	17: 24,502,147	T487K	probably benign	Het
Ccr7	C	T	11: 99,145,378	M239I	probably damaging	Het
Cdh23	C	A	10: 60,410,822	V944L	possibly damaging	Het
Cenpf	A	G	1: 189,683,868	S87P	probably damaging	Het
Chd9	A	T	8: 91,010,676	D1461V	probably benign	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Cyb5r2	A	T	7: 107,753,929	M102K	probably damaging	Het
Cyp2j7	T	C	4: 96,199,450	T408A	possibly damaging	Het
Dnajb2	G	T	1: 75,236,899	E6*	probably null	Het
Eml5	T	C	12: 98,841,548		probably null	Het
Eml6	A	C	11: 29,805,136	S880A	probably damaging	Het
Fsd2	C	T	7: 81,544,967	V483I	probably benign	Het
Inf2	T	C	12: 112,607,581	L773P	unknown	Het
Kif26b	A	G	1: 178,916,965	Q1095R	possibly damaging	Het
Leprotl1	A	G	8: 34,140,759		probably null	Het
Lrp1b	A	G	2: 40,665,087	V340A	unknown	Het
Myh1	T	C	11: 67,211,577	V898A	probably benign	Het
Ncstn	G	T	1: 172,072,544	N254K	probably damaging	Het
Nfatc1	T	A	18: 80,698,368	H139L	possibly damaging	Het
Nfe2l1	C	T	11: 96,819,394		probably null	Het
Nfya	G	T	17: 48,392,884	Y37*	probably null	Het
Obscn	T	C	11: 59,131,646	R758G	possibly damaging	Het
Olfr11	A	G	13: 21,638,782	V247A	probably damaging	Het
Olfr844	T	A	9: 19,319,312	Y265*	probably null	Het
Otogl	C	T	10: 107,771,244	V2093I	probably benign	Het
Phc2	A	G	4: 128,707,983	Y77C	probably damaging	Het
Pik3c2g	C	A	6: 139,730,370	A80E	probably benign	Het
Plxnd1	G	T	6: 115,959,315	H1675N	probably damaging	Het
Pou4f3	A	G	18: 42,395,922	K310R	probably damaging	Het
Ppp1r12c	T	C	7: 4,486,566	D199G	probably damaging	Het
Prss22	A	G	17: 23,993,873	Y297H	probably benign	Het
Psmb7	T	A	2: 38,642,199	H78L	probably damaging	Het
Rad51ap2	T	C	12: 11,458,395	C773R	probably damaging	Het
Rpl12	A	T	2: 32,961,824	N8Y	probably damaging	Het
Ryr3	C	G	2: 112,675,873	R3443P	probably damaging	Het
Sbf1	T	C	15: 89,288,585		probably benign	Het
Scn3a	A	G	2: 65,495,035	I1046T	probably benign	Het
Setd1a	G	A	7: 127,799,202		probably benign	Het
Slc15a2	G	T	16: 36,782,393		probably benign	Het
Slc34a2	G	A	5: 53,064,009	V266I	possibly damaging	Het
Smtn	G	A	11: 3,526,449	T144I	probably benign	Het
Spta1	A	G	1: 174,174,556	N84S	probably benign	Het
Sult6b1	G	T	17: 78,906,862	T6N	probably damaging	Het
Supt16	T	C	14: 52,162,731	E985G	probably damaging	Het
Tbcd	T	A	11: 121,493,811	H39Q	probably benign	Het
Tpo	G	A	12: 30,092,586	P713L	probably damaging	Het
Tsg101	T	A	7: 46,892,494	D99V	probably damaging	Het
Ttn	G	C	2: 76,750,871	A23226G	probably damaging	Het
Ttn	C	T	2: 76,778,465	V15990I	probably benign	Het
Ubald1	C	A	16: 4,875,867	M61I	probably benign	Het
Ush1c	C	T	7: 46,198,445	D465N	probably damaging	Het
Vmn2r-ps159	G	T	4: 156,334,397		noncoding transcript	Het
Vps54	A	G	11: 21,312,877	I655V	probably benign	Het

Other mutations in Dtx4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01533:Dtx4	APN	19	12478215	missense	possibly damaging	0.88
IGL02173:Dtx4	APN	19	12473257	nonsense	probably null
IGL03127:Dtx4	APN	19	12486500	splice site	probably benign
G5030:Dtx4	UTSW	19	12469579	missense	probably benign	0.07
R0143:Dtx4	UTSW	19	12486482	missense	probably damaging	0.98
R0932:Dtx4	UTSW	19	12492151	missense	probably benign
R1066:Dtx4	UTSW	19	12501009	missense	probably damaging	0.98
R2155:Dtx4	UTSW	19	12485282	nonsense	probably null
R2182:Dtx4	UTSW	19	12483107	missense	probably null	0.75
R2362:Dtx4	UTSW	19	12492535	missense	probably damaging	1.00
R3880:Dtx4	UTSW	19	12486456	missense	probably benign	0.01
R4361:Dtx4	UTSW	19	12485296	missense	probably benign	0.04
R4943:Dtx4	UTSW	19	12501060	missense	probably damaging	1.00
R5361:Dtx4	UTSW	19	12485262	critical splice donor site	probably null
R5440:Dtx4	UTSW	19	12492317	missense	probably damaging	1.00
R5613:Dtx4	UTSW	19	12485403	missense	probably damaging	0.97
R5614:Dtx4	UTSW	19	12482183	missense	probably damaging	1.00
R5703:Dtx4	UTSW	19	12482210	missense	possibly damaging	0.84
R5994:Dtx4	UTSW	19	12501153	missense	probably damaging	1.00
R6695:Dtx4	UTSW	19	12473235	nonsense	probably null
R7107:Dtx4	UTSW	19	12473260	nonsense	probably null
R7208:Dtx4	UTSW	19	12482073	critical splice donor site	probably null
R7231:Dtx4	UTSW	19	12469658	nonsense	probably null
R7521:Dtx4	UTSW	19	12492497	missense	probably benign	0.30
R7609:Dtx4	UTSW	19	12492281	missense	probably damaging	1.00
R7721:Dtx4	UTSW	19	12482136	missense	probably benign	0.09
R7775:Dtx4	UTSW	19	12492010	missense	probably benign	0.02
R8685:Dtx4	UTSW	19	12469631	missense	probably benign	0.36
Z1176:Dtx4	UTSW	19	12491909	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CTATAGCTGATACCAGTGAGCAAAG -3'
(R):5'- TTTGCATGAAGCCGCTGGAC -3'

Sequencing Primer
(F):5'- TACCAGTGAGCAAAGCTGGCC -3'
(R):5'- TGTCCCAGTGCCTACGC -3'

Posted On

2015-06-12