Incidental Mutation 'R4161:4833423E24Rik'
ID321509
Institutional Source Beutler Lab
Gene Symbol 4833423E24Rik
Ensembl Gene ENSMUSG00000075217
Gene NameRIKEN cDNA 4833423E24 gene
Synonyms
MMRRC Submission 041004-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R4161 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location85483594-85519024 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 85518509 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 86 (K86N)
Ref Sequence ENSEMBL: ENSMUSP00000097507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099923]
Predicted Effect probably damaging
Transcript: ENSMUST00000099923
AA Change: K86N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097507
Gene: ENSMUSG00000075217
AA Change: K86N

DomainStartEndE-ValueType
Cyt-b5 65 139 6.6e-20 SMART
transmembrane domain 176 195 N/A INTRINSIC
Pfam:FA_desaturase 200 462 1.7e-39 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 95% (39/41)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,049 T593I probably benign Het
Ackr2 A G 9: 121,909,522 Y321C probably benign Het
Angptl3 T C 4: 99,031,491 S163P probably damaging Het
Ankle2 T C 5: 110,234,368 M70T probably benign Het
Ankrd1 T A 19: 36,117,873 K138N probably damaging Het
Ano8 A T 8: 71,482,637 I339N probably damaging Het
Cxcl2 A T 5: 90,904,022 probably null Het
Exosc3 T C 4: 45,320,619 probably benign Het
Fat1 G A 8: 45,036,787 A3579T probably benign Het
Fat4 G A 3: 38,942,809 V1726I possibly damaging Het
Gm5724 T C 6: 141,708,596 K647E probably benign Het
Grm7 A G 6: 111,254,020 N468S probably damaging Het
Hmgcll1 A T 9: 76,074,916 probably benign Het
Igkv3-12 T A 6: 70,518,558 V23E probably benign Het
Irx6 T C 8: 92,676,291 C95R possibly damaging Het
Kif16b G A 2: 142,707,404 H1064Y probably benign Het
Lrrc45 A T 11: 120,718,446 D377V possibly damaging Het
Oasl1 A G 5: 114,937,014 K378E possibly damaging Het
Pds5a T C 5: 65,664,496 T120A possibly damaging Het
Plec T C 15: 76,179,651 E2141G possibly damaging Het
Pou6f1 A G 15: 100,580,843 S395P probably damaging Het
Prss12 A T 3: 123,485,527 K418* probably null Het
Rtn3 G A 19: 7,483,079 A2V probably benign Het
Rubcnl A G 14: 75,044,458 T452A possibly damaging Het
Sdk1 A G 5: 142,114,399 I1395V probably benign Het
Senp7 C A 16: 56,153,469 P351Q possibly damaging Het
Spred3 A G 7: 29,161,785 L323P probably damaging Het
Srprb A G 9: 103,201,330 F67S possibly damaging Het
Tk2 T C 8: 104,238,833 S101G probably benign Het
Tnxb A G 17: 34,711,517 T2059A probably damaging Het
Trpm7 A G 2: 126,816,831 L1135P probably damaging Het
Uhrf1bp1 A G 17: 27,884,087 Y365C probably damaging Het
Ush2a G A 1: 188,728,710 V2723M probably damaging Het
Usp38 C T 8: 80,993,338 A421T probably damaging Het
Vcan G T 13: 89,685,158 N3058K probably damaging Het
Vmn1r221 G A 13: 23,218,006 noncoding transcript Het
Vps11 C G 9: 44,355,720 G406A probably damaging Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Zbtb10 T C 3: 9,280,296 S707P probably damaging Het
Other mutations in 4833423E24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01754:4833423E24Rik APN 2 85518555 missense probably damaging 1.00
IGL02348:4833423E24Rik APN 2 85493296 missense possibly damaging 0.70
IGL02701:4833423E24Rik APN 2 85484169 missense probably damaging 1.00
IGL02833:4833423E24Rik APN 2 85502207 missense possibly damaging 0.46
IGL03152:4833423E24Rik APN 2 85500304 missense probably damaging 0.98
IGL03283:4833423E24Rik APN 2 85490407 missense probably damaging 1.00
R0083:4833423E24Rik UTSW 2 85494132 missense possibly damaging 0.50
R0329:4833423E24Rik UTSW 2 85518551 missense probably benign 0.11
R0330:4833423E24Rik UTSW 2 85518551 missense probably benign 0.11
R0943:4833423E24Rik UTSW 2 85488765 missense probably damaging 0.99
R2100:4833423E24Rik UTSW 2 85500249 missense probably damaging 1.00
R3694:4833423E24Rik UTSW 2 85494110 missense probably benign 0.00
R3803:4833423E24Rik UTSW 2 85508338 splice site probably null
R3952:4833423E24Rik UTSW 2 85500204 splice site probably benign
R4630:4833423E24Rik UTSW 2 85518646 nonsense probably null
R5765:4833423E24Rik UTSW 2 85484194 critical splice acceptor site probably null
R6104:4833423E24Rik UTSW 2 85508349 nonsense probably null
R6314:4833423E24Rik UTSW 2 85502176 missense probably benign 0.07
R6891:4833423E24Rik UTSW 2 85488805 missense possibly damaging 0.80
R6891:4833423E24Rik UTSW 2 85488813 missense probably damaging 1.00
R7027:4833423E24Rik UTSW 2 85485527 missense probably damaging 1.00
R7235:4833423E24Rik UTSW 2 85500219 missense probably damaging 1.00
R7635:4833423E24Rik UTSW 2 85500237 missense probably benign 0.38
R8000:4833423E24Rik UTSW 2 85518726 missense probably benign 0.00
X0021:4833423E24Rik UTSW 2 85518701 missense probably benign 0.00
Z1088:4833423E24Rik UTSW 2 85484181 missense probably damaging 1.00
Z1088:4833423E24Rik UTSW 2 85502077 missense probably benign 0.14
Z1176:4833423E24Rik UTSW 2 85518462 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CAGCAGCATTGTGGAAAGGC -3'
(R):5'- ACCGATAGCTAATGGGAATCC -3'

Sequencing Primer
(F):5'- GGAGGGGAACACACACACAC -3'
(R):5'- TAGCTAATGGGAATCCGACAGC -3'
Posted On2015-06-12