Incidental Mutation 'R4161:Spred3'
ID321524
Institutional Source Beutler Lab
Gene Symbol Spred3
Ensembl Gene ENSMUSG00000037239
Gene Namesprouty-related, EVH1 domain containing 3
SynonymsD130060H24Rik, Spred-3
MMRRC Submission 041004-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4161 (G1)
Quality Score155
Status Validated
Chromosome7
Chromosomal Location29158829-29170411 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29161785 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 323 (L323P)
Ref Sequence ENSEMBL: ENSMUSP00000046216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048923]
Predicted Effect probably damaging
Transcript: ENSMUST00000048923
AA Change: L323P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046216
Gene: ENSMUSG00000037239
AA Change: L323P

DomainStartEndE-ValueType
Pfam:WH1 1 110 1.6e-13 PFAM
low complexity region 120 130 N/A INTRINSIC
low complexity region 142 153 N/A INTRINSIC
Pfam:Sprouty 292 400 7.1e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184073
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205672
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207778
Meta Mutation Damage Score 0.7808 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 95% (39/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a C-terminal Sprouty-like cysteine-rich domain (SRY) and an N-terminal Ena/Vasodilator-stimulated phosphoprotein (VASP) homology-1 (EVH-1) domain. The encoded protein is a member of a family of proteins that negatively regulates mitogen-activated protein (MAP) kinase signaling, particularly during organogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik C A 2: 85,518,509 K86N probably damaging Het
4921501E09Rik G A 17: 33,066,049 T593I probably benign Het
Ackr2 A G 9: 121,909,522 Y321C probably benign Het
Angptl3 T C 4: 99,031,491 S163P probably damaging Het
Ankle2 T C 5: 110,234,368 M70T probably benign Het
Ankrd1 T A 19: 36,117,873 K138N probably damaging Het
Ano8 A T 8: 71,482,637 I339N probably damaging Het
Cxcl2 A T 5: 90,904,022 probably null Het
Exosc3 T C 4: 45,320,619 probably benign Het
Fat1 G A 8: 45,036,787 A3579T probably benign Het
Fat4 G A 3: 38,942,809 V1726I possibly damaging Het
Gm5724 T C 6: 141,708,596 K647E probably benign Het
Grm7 A G 6: 111,254,020 N468S probably damaging Het
Hmgcll1 A T 9: 76,074,916 probably benign Het
Igkv3-12 T A 6: 70,518,558 V23E probably benign Het
Irx6 T C 8: 92,676,291 C95R possibly damaging Het
Kif16b G A 2: 142,707,404 H1064Y probably benign Het
Lrrc45 A T 11: 120,718,446 D377V possibly damaging Het
Oasl1 A G 5: 114,937,014 K378E possibly damaging Het
Pds5a T C 5: 65,664,496 T120A possibly damaging Het
Plec T C 15: 76,179,651 E2141G possibly damaging Het
Pou6f1 A G 15: 100,580,843 S395P probably damaging Het
Prss12 A T 3: 123,485,527 K418* probably null Het
Rtn3 G A 19: 7,483,079 A2V probably benign Het
Rubcnl A G 14: 75,044,458 T452A possibly damaging Het
Sdk1 A G 5: 142,114,399 I1395V probably benign Het
Senp7 C A 16: 56,153,469 P351Q possibly damaging Het
Srprb A G 9: 103,201,330 F67S possibly damaging Het
Tk2 T C 8: 104,238,833 S101G probably benign Het
Tnxb A G 17: 34,711,517 T2059A probably damaging Het
Trpm7 A G 2: 126,816,831 L1135P probably damaging Het
Uhrf1bp1 A G 17: 27,884,087 Y365C probably damaging Het
Ush2a G A 1: 188,728,710 V2723M probably damaging Het
Usp38 C T 8: 80,993,338 A421T probably damaging Het
Vcan G T 13: 89,685,158 N3058K probably damaging Het
Vmn1r221 G A 13: 23,218,006 noncoding transcript Het
Vps11 C G 9: 44,355,720 G406A probably damaging Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Zbtb10 T C 3: 9,280,296 S707P probably damaging Het
Other mutations in Spred3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Spred3 APN 7 29161523 utr 3 prime probably benign
IGL02391:Spred3 APN 7 29166405 missense probably benign 0.00
IGL03355:Spred3 APN 7 29161572 missense unknown
R0480:Spred3 UTSW 7 29162975 missense probably damaging 0.99
R2396:Spred3 UTSW 7 29166634 missense probably damaging 1.00
R4899:Spred3 UTSW 7 29161833 missense probably damaging 1.00
R4974:Spred3 UTSW 7 29167824 missense probably damaging 1.00
R5291:Spred3 UTSW 7 29167830 missense probably damaging 1.00
R6192:Spred3 UTSW 7 29162977 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GCTCAACAATCCTCACCGTG -3'
(R):5'- TTTGCCAAGACTGGTGCATTG -3'

Sequencing Primer
(F):5'- TGCTGCAACCCAGTGACAG -3'
(R):5'- TCTCACAGAGGCTGCACC -3'
Posted On2015-06-12