Incidental Mutation 'R4161:Ano8'
ID321526
Institutional Source Beutler Lab
Gene Symbol Ano8
Ensembl Gene ENSMUSG00000034863
Gene Nameanoctamin 8
SynonymsTmem16h
MMRRC Submission 041004-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4161 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location71476019-71485963 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71482637 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 339 (I339N)
Ref Sequence ENSEMBL: ENSMUSP00000091157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093450] [ENSMUST00000213382]
Predicted Effect probably damaging
Transcript: ENSMUST00000093450
AA Change: I339N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091157
Gene: ENSMUSG00000034863
AA Change: I339N

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
low complexity region 73 84 N/A INTRINSIC
Pfam:Anoctamin 237 874 3e-149 PFAM
coiled coil region 881 919 N/A INTRINSIC
low complexity region 948 964 N/A INTRINSIC
low complexity region 974 988 N/A INTRINSIC
low complexity region 1042 1056 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213016
Predicted Effect probably damaging
Transcript: ENSMUST00000213382
AA Change: I339N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.4384 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 95% (39/41)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik C A 2: 85,518,509 K86N probably damaging Het
4921501E09Rik G A 17: 33,066,049 T593I probably benign Het
Ackr2 A G 9: 121,909,522 Y321C probably benign Het
Angptl3 T C 4: 99,031,491 S163P probably damaging Het
Ankle2 T C 5: 110,234,368 M70T probably benign Het
Ankrd1 T A 19: 36,117,873 K138N probably damaging Het
Cxcl2 A T 5: 90,904,022 probably null Het
Exosc3 T C 4: 45,320,619 probably benign Het
Fat1 G A 8: 45,036,787 A3579T probably benign Het
Fat4 G A 3: 38,942,809 V1726I possibly damaging Het
Gm5724 T C 6: 141,708,596 K647E probably benign Het
Grm7 A G 6: 111,254,020 N468S probably damaging Het
Hmgcll1 A T 9: 76,074,916 probably benign Het
Igkv3-12 T A 6: 70,518,558 V23E probably benign Het
Irx6 T C 8: 92,676,291 C95R possibly damaging Het
Kif16b G A 2: 142,707,404 H1064Y probably benign Het
Lrrc45 A T 11: 120,718,446 D377V possibly damaging Het
Oasl1 A G 5: 114,937,014 K378E possibly damaging Het
Pds5a T C 5: 65,664,496 T120A possibly damaging Het
Plec T C 15: 76,179,651 E2141G possibly damaging Het
Pou6f1 A G 15: 100,580,843 S395P probably damaging Het
Prss12 A T 3: 123,485,527 K418* probably null Het
Rtn3 G A 19: 7,483,079 A2V probably benign Het
Rubcnl A G 14: 75,044,458 T452A possibly damaging Het
Sdk1 A G 5: 142,114,399 I1395V probably benign Het
Senp7 C A 16: 56,153,469 P351Q possibly damaging Het
Spred3 A G 7: 29,161,785 L323P probably damaging Het
Srprb A G 9: 103,201,330 F67S possibly damaging Het
Tk2 T C 8: 104,238,833 S101G probably benign Het
Tnxb A G 17: 34,711,517 T2059A probably damaging Het
Trpm7 A G 2: 126,816,831 L1135P probably damaging Het
Uhrf1bp1 A G 17: 27,884,087 Y365C probably damaging Het
Ush2a G A 1: 188,728,710 V2723M probably damaging Het
Usp38 C T 8: 80,993,338 A421T probably damaging Het
Vcan G T 13: 89,685,158 N3058K probably damaging Het
Vmn1r221 G A 13: 23,218,006 noncoding transcript Het
Vps11 C G 9: 44,355,720 G406A probably damaging Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Zbtb10 T C 3: 9,280,296 S707P probably damaging Het
Other mutations in Ano8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Ano8 APN 8 71484258 splice site probably benign
IGL00501:Ano8 APN 8 71479149 critical splice donor site probably null
IGL01380:Ano8 APN 8 71480809 unclassified probably benign
IGL02138:Ano8 APN 8 71484842 missense probably damaging 0.99
IGL02516:Ano8 APN 8 71485077 missense probably damaging 1.00
IGL02675:Ano8 APN 8 71483540 missense probably damaging 0.99
IGL02995:Ano8 APN 8 71483117 missense possibly damaging 0.72
H8786:Ano8 UTSW 8 71478744 unclassified probably benign
R0265:Ano8 UTSW 8 71480524 unclassified probably benign
R0282:Ano8 UTSW 8 71480614 unclassified probably benign
R0518:Ano8 UTSW 8 71479258 missense probably benign 0.39
R0521:Ano8 UTSW 8 71479258 missense probably benign 0.39
R1028:Ano8 UTSW 8 71480971 small deletion probably benign
R1147:Ano8 UTSW 8 71482017 missense probably damaging 1.00
R1147:Ano8 UTSW 8 71482017 missense probably damaging 1.00
R1748:Ano8 UTSW 8 71478958 unclassified probably benign
R1852:Ano8 UTSW 8 71483487 missense probably damaging 0.99
R4192:Ano8 UTSW 8 71483292 missense probably damaging 1.00
R4274:Ano8 UTSW 8 71478741 unclassified probably benign
R4834:Ano8 UTSW 8 71484295 missense probably damaging 1.00
R4961:Ano8 UTSW 8 71482996 missense probably damaging 1.00
R5252:Ano8 UTSW 8 71482617 missense probably damaging 1.00
R5553:Ano8 UTSW 8 71484997 splice site probably null
R5598:Ano8 UTSW 8 71482577 missense probably damaging 1.00
R5695:Ano8 UTSW 8 71483243 missense probably damaging 0.98
R5994:Ano8 UTSW 8 71484834 missense probably damaging 1.00
R6019:Ano8 UTSW 8 71482380 missense probably damaging 1.00
R6153:Ano8 UTSW 8 71480797 unclassified probably benign
R6405:Ano8 UTSW 8 71483030 missense probably damaging 1.00
R6516:Ano8 UTSW 8 71481780 splice site probably null
R6539:Ano8 UTSW 8 71484483 missense probably damaging 1.00
R7194:Ano8 UTSW 8 71482363 missense possibly damaging 0.66
R7204:Ano8 UTSW 8 71479025 missense probably benign 0.39
R7340:Ano8 UTSW 8 71483011 missense probably damaging 0.99
R7365:Ano8 UTSW 8 71485110 missense probably damaging 1.00
R7417:Ano8 UTSW 8 71480833 missense unknown
R7486:Ano8 UTSW 8 71484998 critical splice donor site probably null
R7644:Ano8 UTSW 8 71484830 missense probably damaging 0.98
R7709:Ano8 UTSW 8 71482289 missense probably damaging 1.00
R7719:Ano8 UTSW 8 71483140 missense possibly damaging 0.82
R8040:Ano8 UTSW 8 71482168 missense probably benign 0.26
R8219:Ano8 UTSW 8 71480713 missense unknown
R8401:Ano8 UTSW 8 71483367 missense probably damaging 1.00
X0026:Ano8 UTSW 8 71479157 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GCATAACCTTGGGCAAGAAGC -3'
(R):5'- CAGAGAAGTTTGTGGGCCAG -3'

Sequencing Primer
(F):5'- TGAAGCTGGACCTGGTGC -3'
(R):5'- CCAGGGAGGCTTGTGACAG -3'
Posted On2015-06-12