Incidental Mutation 'R4161:Ankrd1'
ID321546
Institutional Source Beutler Lab
Gene Symbol Ankrd1
Ensembl Gene ENSMUSG00000024803
Gene Nameankyrin repeat domain 1 (cardiac muscle)
SynonymsMARP1, CARP, Alrp, Crap
MMRRC Submission 041004-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4161 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location36111965-36119844 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36117873 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 138 (K138N)
Ref Sequence ENSEMBL: ENSMUSP00000025718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025718]
Predicted Effect probably damaging
Transcript: ENSMUST00000025718
AA Change: K138N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025718
Gene: ENSMUSG00000024803
AA Change: K138N

DomainStartEndE-ValueType
coiled coil region 53 88 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
Blast:ANK 119 148 1e-10 BLAST
ANK 152 181 4.56e-4 SMART
ANK 185 214 3.28e-5 SMART
ANK 218 247 4.89e-4 SMART
ANK 251 280 6.92e-4 SMART
Blast:ANK 285 313 5e-8 BLAST
Meta Mutation Damage Score 0.2300 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 95% (39/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is localized to the nucleus of endothelial cells and is induced by IL-1 and TNF-alpha stimulation. Studies in rat cardiomyocytes suggest that this gene functions as a transcription factor. Interactions between this protein and the sarcomeric proteins myopalladin and titin suggest that it may also be involved in the myofibrillar stretch-sensor system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele are viable, fertile, and show no apparent cardiac phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik C A 2: 85,518,509 K86N probably damaging Het
4921501E09Rik G A 17: 33,066,049 T593I probably benign Het
Ackr2 A G 9: 121,909,522 Y321C probably benign Het
Angptl3 T C 4: 99,031,491 S163P probably damaging Het
Ankle2 T C 5: 110,234,368 M70T probably benign Het
Ano8 A T 8: 71,482,637 I339N probably damaging Het
Cxcl2 A T 5: 90,904,022 probably null Het
Exosc3 T C 4: 45,320,619 probably benign Het
Fat1 G A 8: 45,036,787 A3579T probably benign Het
Fat4 G A 3: 38,942,809 V1726I possibly damaging Het
Gm5724 T C 6: 141,708,596 K647E probably benign Het
Grm7 A G 6: 111,254,020 N468S probably damaging Het
Hmgcll1 A T 9: 76,074,916 probably benign Het
Igkv3-12 T A 6: 70,518,558 V23E probably benign Het
Irx6 T C 8: 92,676,291 C95R possibly damaging Het
Kif16b G A 2: 142,707,404 H1064Y probably benign Het
Lrrc45 A T 11: 120,718,446 D377V possibly damaging Het
Oasl1 A G 5: 114,937,014 K378E possibly damaging Het
Pds5a T C 5: 65,664,496 T120A possibly damaging Het
Plec T C 15: 76,179,651 E2141G possibly damaging Het
Pou6f1 A G 15: 100,580,843 S395P probably damaging Het
Prss12 A T 3: 123,485,527 K418* probably null Het
Rtn3 G A 19: 7,483,079 A2V probably benign Het
Rubcnl A G 14: 75,044,458 T452A possibly damaging Het
Sdk1 A G 5: 142,114,399 I1395V probably benign Het
Senp7 C A 16: 56,153,469 P351Q possibly damaging Het
Spred3 A G 7: 29,161,785 L323P probably damaging Het
Srprb A G 9: 103,201,330 F67S possibly damaging Het
Tk2 T C 8: 104,238,833 S101G probably benign Het
Tnxb A G 17: 34,711,517 T2059A probably damaging Het
Trpm7 A G 2: 126,816,831 L1135P probably damaging Het
Uhrf1bp1 A G 17: 27,884,087 Y365C probably damaging Het
Ush2a G A 1: 188,728,710 V2723M probably damaging Het
Usp38 C T 8: 80,993,338 A421T probably damaging Het
Vcan G T 13: 89,685,158 N3058K probably damaging Het
Vmn1r221 G A 13: 23,218,006 noncoding transcript Het
Vps11 C G 9: 44,355,720 G406A probably damaging Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Zbtb10 T C 3: 9,280,296 S707P probably damaging Het
Other mutations in Ankrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02210:Ankrd1 APN 19 36118314 missense probably damaging 1.00
IGL02383:Ankrd1 APN 19 36119765 missense probably benign 0.25
IGL02538:Ankrd1 APN 19 36115056 missense probably damaging 1.00
R0143:Ankrd1 UTSW 19 36119313 missense probably benign 0.07
R1302:Ankrd1 UTSW 19 36115003 missense probably damaging 1.00
R1800:Ankrd1 UTSW 19 36119359 missense probably damaging 1.00
R1832:Ankrd1 UTSW 19 36114978 missense possibly damaging 0.94
R1855:Ankrd1 UTSW 19 36119235 missense probably damaging 1.00
R4158:Ankrd1 UTSW 19 36117873 missense probably damaging 1.00
R4160:Ankrd1 UTSW 19 36117873 missense probably damaging 1.00
R4930:Ankrd1 UTSW 19 36115033 missense probably damaging 0.99
R5929:Ankrd1 UTSW 19 36117877 missense possibly damaging 0.94
R7057:Ankrd1 UTSW 19 36118233 missense possibly damaging 0.78
R7836:Ankrd1 UTSW 19 36115522 missense possibly damaging 0.93
R7846:Ankrd1 UTSW 19 36116818 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCTCATGCAATCCATCATGC -3'
(R):5'- GACGGCAGCAAAACTCATGG -3'

Sequencing Primer
(F):5'- GAGGGGAACAATAATCTCTCTCTCTC -3'
(R):5'- GCAAAACTCATGGCCACTTTCG -3'
Posted On2015-06-12