Incidental Mutation 'R4162:Plcb2'
ID321552
Institutional Source Beutler Lab
Gene Symbol Plcb2
Ensembl Gene ENSMUSG00000040061
Gene Namephospholipase C, beta 2
SynonymsB230205M18Rik
MMRRC Submission 041005-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4162 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location118707517-118728438 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118709587 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 1075 (E1075V)
Ref Sequence ENSEMBL: ENSMUSP00000124364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102524] [ENSMUST00000159756]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000006415
Predicted Effect probably damaging
Transcript: ENSMUST00000102524
AA Change: E1098V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099583
Gene: ENSMUSG00000040061
AA Change: E1098V

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:EF-hand_like 220 311 2.5e-24 PFAM
PLCXc 312 463 2.87e-79 SMART
low complexity region 504 518 N/A INTRINSIC
PLCYc 547 663 2.39e-67 SMART
C2 684 783 9.17e-15 SMART
low complexity region 902 925 N/A INTRINSIC
low complexity region 929 940 N/A INTRINSIC
Pfam:PLC-beta_C 974 1149 4.7e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126907
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127248
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129153
Predicted Effect probably damaging
Transcript: ENSMUST00000159756
AA Change: E1075V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124364
Gene: ENSMUSG00000040061
AA Change: E1075V

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:EF-hand_like 197 288 7.1e-26 PFAM
PLCXc 289 440 2.87e-79 SMART
low complexity region 481 495 N/A INTRINSIC
PLCYc 524 640 2.39e-67 SMART
C2 661 760 9.17e-15 SMART
low complexity region 879 902 N/A INTRINSIC
low complexity region 906 917 N/A INTRINSIC
Pfam:PLC-beta_C 946 1129 5.1e-68 PFAM
Meta Mutation Damage Score 0.1017 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 93% (38/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a phosphodiesterase that catalyzes the hydrolysis of phosphatidylinositol 4,5-bisphosphate to the second messengers inositol 1,4,5-trisphosphate (IP3) and diacylglycerol. The encoded protein is activated by G proteins and has been shown to be involved in the type 2 taste receptor signal transduction pathway. In addition, nuclear factor kappa B can regulate the transcription of this gene, whose protein product is also an important regulator of platelet responses. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous mutant mice showed an increased sensitivity to both bacterial and viral infections and exhibited abnormal taste perception in which sweet, umami, and bitter stimuli could not be sensed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 T A 10: 83,506,654 I431F possibly damaging Het
Atrn A G 2: 130,994,228 probably benign Het
BC017643 T C 11: 121,224,666 D109G probably damaging Het
Cep57 C T 9: 13,812,633 probably null Het
Defb41 C T 1: 18,260,597 C42Y probably damaging Het
Dnah3 C T 7: 119,922,838 G4033D probably damaging Het
Flnb A T 14: 7,915,374 I1502F possibly damaging Het
Gli3 G T 13: 15,725,115 S1029I possibly damaging Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Gm5592 A G 7: 41,217,778 probably benign Het
Grin2d T C 7: 45,857,618 K478E probably damaging Het
Il18 T C 9: 50,579,412 S116P probably damaging Het
Itsn1 C A 16: 91,852,902 P155T probably benign Het
Kdm5b C T 1: 134,625,161 P1292S probably benign Het
Mb21d1 G A 9: 78,434,404 R364C probably damaging Het
Mef2b T C 8: 70,166,311 F181S probably damaging Het
Mfn1 T C 3: 32,562,998 probably benign Het
Mfsd12 A G 10: 81,361,097 probably null Het
Myo10 T A 15: 25,726,415 probably null Het
Nrxn2 G A 19: 6,532,143 V660I probably damaging Het
Nsun4 G T 4: 116,034,194 Y329* probably null Het
Pank4 T C 4: 154,979,594 probably null Het
Prep G T 10: 45,067,362 R11L possibly damaging Het
Prkcd A G 14: 30,601,197 F461L probably damaging Het
Snx21 T C 2: 164,786,850 Y138H probably damaging Het
Spout1 C T 2: 30,177,577 probably benign Het
Tex15 T C 8: 33,581,558 S2378P probably damaging Het
Tex45 C T 8: 3,479,067 P214L probably damaging Het
Thap12 C T 7: 98,710,078 probably benign Het
Trav3-1 T C 14: 52,581,039 Y57H probably damaging Het
Ttc39c A G 18: 12,724,937 probably null Het
Tubgcp3 C T 8: 12,639,547 R573Q possibly damaging Het
Ush2a A C 1: 188,743,680 K2938T probably benign Het
Vasp A T 7: 19,259,472 probably null Het
Zfhx3 C A 8: 108,956,987 T3686K unknown Het
Other mutations in Plcb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Plcb2 APN 2 118718889 missense probably damaging 1.00
IGL00715:Plcb2 APN 2 118713734 critical splice donor site probably null
IGL00851:Plcb2 APN 2 118728251 missense probably benign 0.30
IGL01765:Plcb2 APN 2 118710268 splice site probably benign
IGL01837:Plcb2 APN 2 118711926 splice site probably null
IGL01868:Plcb2 APN 2 118709590 missense probably damaging 1.00
IGL01868:Plcb2 APN 2 118711387 missense probably benign 0.09
IGL02158:Plcb2 APN 2 118711363 missense probably benign 0.06
IGL02447:Plcb2 APN 2 118713155 missense probably damaging 1.00
IGL02490:Plcb2 APN 2 118719760 missense probably damaging 0.99
IGL02691:Plcb2 APN 2 118710963 missense probably benign 0.00
IGL02723:Plcb2 APN 2 118717019 splice site probably benign
IGL02929:Plcb2 APN 2 118713234 splice site probably benign
IGL02949:Plcb2 APN 2 118719109 splice site probably null
PIT4480001:Plcb2 UTSW 2 118723496 missense probably benign 0.00
R0031:Plcb2 UTSW 2 118715461 missense probably benign 0.36
R0157:Plcb2 UTSW 2 118718541 missense probably damaging 0.98
R0366:Plcb2 UTSW 2 118724447 missense probably benign 0.01
R0376:Plcb2 UTSW 2 118717240 missense probably damaging 0.99
R0570:Plcb2 UTSW 2 118717325 missense probably benign 0.32
R0790:Plcb2 UTSW 2 118712483 splice site probably benign
R0893:Plcb2 UTSW 2 118725105 splice site probably benign
R1647:Plcb2 UTSW 2 118723780 missense possibly damaging 0.51
R1648:Plcb2 UTSW 2 118723780 missense possibly damaging 0.51
R1686:Plcb2 UTSW 2 118715687 splice site probably benign
R2210:Plcb2 UTSW 2 118717503 missense probably damaging 1.00
R2211:Plcb2 UTSW 2 118723534 missense probably benign 0.05
R2251:Plcb2 UTSW 2 118723765 missense probably benign 0.10
R2252:Plcb2 UTSW 2 118723765 missense probably benign 0.10
R2253:Plcb2 UTSW 2 118723765 missense probably benign 0.10
R2426:Plcb2 UTSW 2 118715649 missense probably damaging 1.00
R3970:Plcb2 UTSW 2 118715690 splice site probably benign
R4007:Plcb2 UTSW 2 118710793 missense probably damaging 1.00
R4236:Plcb2 UTSW 2 118709566 missense probably damaging 1.00
R4422:Plcb2 UTSW 2 118712003 missense probably benign 0.28
R4772:Plcb2 UTSW 2 118713134 missense probably benign 0.20
R4795:Plcb2 UTSW 2 118711124 missense probably benign 0.32
R4935:Plcb2 UTSW 2 118718915 missense probably damaging 1.00
R5019:Plcb2 UTSW 2 118712136 missense probably benign 0.01
R5055:Plcb2 UTSW 2 118718222 missense probably benign 0.06
R5452:Plcb2 UTSW 2 118718246 missense probably damaging 0.98
R5622:Plcb2 UTSW 2 118714729 missense probably damaging 1.00
R5752:Plcb2 UTSW 2 118711051 intron probably benign
R6284:Plcb2 UTSW 2 118717301 missense probably benign 0.37
R6380:Plcb2 UTSW 2 118715468 missense probably damaging 1.00
R6574:Plcb2 UTSW 2 118719173 missense probably damaging 0.99
R6728:Plcb2 UTSW 2 118723690 missense probably damaging 1.00
R6792:Plcb2 UTSW 2 118719441 missense probably damaging 1.00
R7529:Plcb2 UTSW 2 118710234 missense probably damaging 1.00
R7560:Plcb2 UTSW 2 118715643 missense probably damaging 0.99
R7610:Plcb2 UTSW 2 118719759 missense possibly damaging 0.86
R7760:Plcb2 UTSW 2 118711388 missense probably benign
R8152:Plcb2 UTSW 2 118710821 missense probably benign 0.22
R8170:Plcb2 UTSW 2 118711453 missense possibly damaging 0.68
R8413:Plcb2 UTSW 2 118718823 missense probably damaging 1.00
R8913:Plcb2 UTSW 2 118713884 missense probably damaging 1.00
X0024:Plcb2 UTSW 2 118712375 missense probably benign 0.13
Z1176:Plcb2 UTSW 2 118723128 missense probably damaging 0.99
Z1177:Plcb2 UTSW 2 118709200 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACACCATGAGAACCTGCCTG -3'
(R):5'- GACCTAAAACTCCTTCCCTGGG -3'

Sequencing Primer
(F):5'- TGTGGCCCACTGCTGAG -3'
(R):5'- GTGGACCAGACATGTGATCCTTC -3'
Posted On2015-06-12