Incidental Mutation 'R4162:Snx21'
ID321554
Institutional Source Beutler Lab
Gene Symbol Snx21
Ensembl Gene ENSMUSG00000050373
Gene Namesorting nexin family member 21
Synonyms
MMRRC Submission 041005-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4162 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location164785823-164793816 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 164786850 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 138 (Y138H)
Ref Sequence ENSEMBL: ENSMUSP00000054137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056181] [ENSMUST00000152471] [ENSMUST00000172577] [ENSMUST00000172577] [ENSMUST00000174070]
Predicted Effect probably damaging
Transcript: ENSMUST00000056181
AA Change: Y138H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054137
Gene: ENSMUSG00000050373
AA Change: Y138H

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 17 28 N/A INTRINSIC
low complexity region 58 69 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
PX 124 232 4.19e-10 SMART
low complexity region 249 263 N/A INTRINSIC
low complexity region 334 343 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000140519
AA Change: Y19H
Predicted Effect probably damaging
Transcript: ENSMUST00000152471
AA Change: Y138H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133914
Gene: ENSMUSG00000050373
AA Change: Y138H

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 17 28 N/A INTRINSIC
low complexity region 58 69 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172577
SMART Domains Protein: ENSMUSP00000134133
Gene: ENSMUSG00000050373

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 17 28 N/A INTRINSIC
low complexity region 58 69 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172577
SMART Domains Protein: ENSMUSP00000134133
Gene: ENSMUSG00000050373

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 17 28 N/A INTRINSIC
low complexity region 58 69 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173945
Predicted Effect probably damaging
Transcript: ENSMUST00000174070
AA Change: Y138H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000133344
Gene: ENSMUSG00000050373
AA Change: Y138H

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 17 28 N/A INTRINSIC
low complexity region 58 69 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174342
Meta Mutation Damage Score 0.8842 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 93% (38/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein does not contain a coiled coil region, like some family members. The specific function of this protein has not been determined. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 T A 10: 83,506,654 I431F possibly damaging Het
Atrn A G 2: 130,994,228 probably benign Het
BC017643 T C 11: 121,224,666 D109G probably damaging Het
Cep57 C T 9: 13,812,633 probably null Het
Defb41 C T 1: 18,260,597 C42Y probably damaging Het
Dnah3 C T 7: 119,922,838 G4033D probably damaging Het
Flnb A T 14: 7,915,374 I1502F possibly damaging Het
Gli3 G T 13: 15,725,115 S1029I possibly damaging Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Gm5592 A G 7: 41,217,778 probably benign Het
Grin2d T C 7: 45,857,618 K478E probably damaging Het
Il18 T C 9: 50,579,412 S116P probably damaging Het
Itsn1 C A 16: 91,852,902 P155T probably benign Het
Kdm5b C T 1: 134,625,161 P1292S probably benign Het
Mb21d1 G A 9: 78,434,404 R364C probably damaging Het
Mef2b T C 8: 70,166,311 F181S probably damaging Het
Mfn1 T C 3: 32,562,998 probably benign Het
Mfsd12 A G 10: 81,361,097 probably null Het
Myo10 T A 15: 25,726,415 probably null Het
Nrxn2 G A 19: 6,532,143 V660I probably damaging Het
Nsun4 G T 4: 116,034,194 Y329* probably null Het
Pank4 T C 4: 154,979,594 probably null Het
Plcb2 T A 2: 118,709,587 E1075V probably damaging Het
Prep G T 10: 45,067,362 R11L possibly damaging Het
Prkcd A G 14: 30,601,197 F461L probably damaging Het
Spout1 C T 2: 30,177,577 probably benign Het
Tex15 T C 8: 33,581,558 S2378P probably damaging Het
Tex45 C T 8: 3,479,067 P214L probably damaging Het
Thap12 C T 7: 98,710,078 probably benign Het
Trav3-1 T C 14: 52,581,039 Y57H probably damaging Het
Ttc39c A G 18: 12,724,937 probably null Het
Tubgcp3 C T 8: 12,639,547 R573Q possibly damaging Het
Ush2a A C 1: 188,743,680 K2938T probably benign Het
Vasp A T 7: 19,259,472 probably null Het
Zfhx3 C A 8: 108,956,987 T3686K unknown Het
Other mutations in Snx21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Snx21 APN 2 164786220 missense probably damaging 1.00
IGL02329:Snx21 APN 2 164792390 utr 3 prime probably benign
R4164:Snx21 UTSW 2 164786850 missense probably damaging 1.00
R5092:Snx21 UTSW 2 164786746 missense probably damaging 0.99
R5262:Snx21 UTSW 2 164791821 missense probably damaging 0.99
R6875:Snx21 UTSW 2 164791902 missense probably damaging 1.00
R7231:Snx21 UTSW 2 164786201 missense probably benign 0.00
R7757:Snx21 UTSW 2 164786165 missense probably damaging 1.00
R8001:Snx21 UTSW 2 164786737 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTTAACTCTGGAGCTAGCCAC -3'
(R):5'- AGTCATTTGCCTGAGGACGTG -3'

Sequencing Primer
(F):5'- ACCCCCATAATGACGGGTC -3'
(R):5'- AGGACGTGTTCAGTTGACACC -3'
Posted On2015-06-12