Incidental Mutation 'R4162:Thap12'
ID 321561
Institutional Source Beutler Lab
Gene Symbol Thap12
Ensembl Gene ENSMUSG00000030753
Gene Name THAP domain containing 12
Synonyms Prkrir, Dap4, 2900052B10Rik
MMRRC Submission 041005-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock # R4162 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 98703103-98718062 bp(+) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) C to T at 98710078 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033009] [ENSMUST00000126356] [ENSMUST00000153566]
AlphaFold Q9CUX1
Predicted Effect probably benign
Transcript: ENSMUST00000033009
SMART Domains Protein: ENSMUSP00000033009
Gene: ENSMUSG00000030753

DomainStartEndE-ValueType
THAP 3 92 8.38e-22 SMART
DM3 21 91 1.49e-20 SMART
Pfam:DUF4371 112 338 1.9e-22 PFAM
low complexity region 433 445 N/A INTRINSIC
Pfam:Dimer_Tnp_hAT 631 726 6.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126356
SMART Domains Protein: ENSMUSP00000118403
Gene: ENSMUSG00000030753

DomainStartEndE-ValueType
THAP 3 78 3.21e-9 SMART
DM3 21 78 1.89e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146473
Predicted Effect probably benign
Transcript: ENSMUST00000153566
SMART Domains Protein: ENSMUSP00000118736
Gene: ENSMUSG00000030753

DomainStartEndE-ValueType
THAP 3 92 8.38e-22 SMART
DM3 21 91 1.49e-20 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 93% (38/41)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 T A 10: 83,506,654 I431F possibly damaging Het
Atrn A G 2: 130,994,228 probably benign Het
BC017643 T C 11: 121,224,666 D109G probably damaging Het
Cep57 C T 9: 13,812,633 probably null Het
Defb41 C T 1: 18,260,597 C42Y probably damaging Het
Dnah3 C T 7: 119,922,838 G4033D probably damaging Het
Flnb A T 14: 7,915,374 I1502F possibly damaging Het
Gli3 G T 13: 15,725,115 S1029I possibly damaging Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Gm5592 A G 7: 41,217,778 probably benign Het
Grin2d T C 7: 45,857,618 K478E probably damaging Het
Il18 T C 9: 50,579,412 S116P probably damaging Het
Itsn1 C A 16: 91,852,902 P155T probably benign Het
Kdm5b C T 1: 134,625,161 P1292S probably benign Het
Mb21d1 G A 9: 78,434,404 R364C probably damaging Het
Mef2b T C 8: 70,166,311 F181S probably damaging Het
Mfn1 T C 3: 32,562,998 probably benign Het
Mfsd12 A G 10: 81,361,097 probably null Het
Myo10 T A 15: 25,726,415 probably null Het
Nrxn2 G A 19: 6,532,143 V660I probably damaging Het
Nsun4 G T 4: 116,034,194 Y329* probably null Het
Pank4 T C 4: 154,979,594 probably null Het
Plcb2 T A 2: 118,709,587 E1075V probably damaging Het
Prep G T 10: 45,067,362 R11L possibly damaging Het
Prkcd A G 14: 30,601,197 F461L probably damaging Het
Snx21 T C 2: 164,786,850 Y138H probably damaging Het
Spout1 C T 2: 30,177,577 probably benign Het
Tex15 T C 8: 33,581,558 S2378P probably damaging Het
Tex45 C T 8: 3,479,067 P214L probably damaging Het
Trav3-1 T C 14: 52,581,039 Y57H probably damaging Het
Ttc39c A G 18: 12,724,937 probably null Het
Tubgcp3 C T 8: 12,639,547 R573Q possibly damaging Het
Ush2a A C 1: 188,743,680 K2938T probably benign Het
Vasp A T 7: 19,259,472 probably null Het
Zfhx3 C A 8: 108,956,987 T3686K unknown Het
Other mutations in Thap12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Thap12 APN 7 98716137 missense possibly damaging 0.82
IGL01145:Thap12 APN 7 98712903 makesense probably null
IGL01973:Thap12 APN 7 98716499 missense possibly damaging 0.58
IGL02404:Thap12 APN 7 98710133 missense probably damaging 1.00
H8562:Thap12 UTSW 7 98715107 missense probably damaging 0.98
PIT4453001:Thap12 UTSW 7 98715038 missense probably benign 0.00
R0090:Thap12 UTSW 7 98715893 missense probably damaging 1.00
R0254:Thap12 UTSW 7 98715281 missense probably benign 0.03
R1344:Thap12 UTSW 7 98716830 missense probably damaging 0.97
R1384:Thap12 UTSW 7 98703438 missense probably damaging 0.98
R1418:Thap12 UTSW 7 98716830 missense probably damaging 0.97
R1448:Thap12 UTSW 7 98716023 missense probably benign 0.01
R1493:Thap12 UTSW 7 98715438 missense probably benign 0.30
R1906:Thap12 UTSW 7 98716740 missense probably damaging 1.00
R1932:Thap12 UTSW 7 98716838 missense possibly damaging 0.77
R1992:Thap12 UTSW 7 98716365 missense possibly damaging 0.68
R2044:Thap12 UTSW 7 98716620 missense probably damaging 1.00
R2092:Thap12 UTSW 7 98716449 missense possibly damaging 0.70
R2160:Thap12 UTSW 7 98710126 missense probably damaging 0.97
R3850:Thap12 UTSW 7 98716663 missense probably damaging 1.00
R4086:Thap12 UTSW 7 98716494 missense possibly damaging 0.94
R4554:Thap12 UTSW 7 98715845 missense probably benign 0.00
R4555:Thap12 UTSW 7 98715845 missense probably benign 0.00
R4556:Thap12 UTSW 7 98715845 missense probably benign 0.00
R4557:Thap12 UTSW 7 98715845 missense probably benign 0.00
R4659:Thap12 UTSW 7 98710091 intron probably benign
R4734:Thap12 UTSW 7 98715954 missense probably damaging 0.98
R4734:Thap12 UTSW 7 98715955 nonsense probably null
R5794:Thap12 UTSW 7 98716393 missense probably benign 0.11
R5994:Thap12 UTSW 7 98716030 nonsense probably null
R6298:Thap12 UTSW 7 98703405 missense probably damaging 1.00
R6515:Thap12 UTSW 7 98707095 missense probably damaging 0.97
R6624:Thap12 UTSW 7 98715586 nonsense probably null
R6625:Thap12 UTSW 7 98716070 missense probably benign 0.00
R6965:Thap12 UTSW 7 98715462 missense probably damaging 1.00
R7560:Thap12 UTSW 7 98710231 missense probably damaging 0.99
R8713:Thap12 UTSW 7 98707076 missense probably benign 0.30
R8897:Thap12 UTSW 7 98715327 missense probably benign 0.38
R9099:Thap12 UTSW 7 98715393 missense probably damaging 1.00
R9260:Thap12 UTSW 7 98707073 nonsense probably null
R9339:Thap12 UTSW 7 98715116 missense possibly damaging 0.95
R9467:Thap12 UTSW 7 98710141 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTAACAACGGCAGTGGAGTG -3'
(R):5'- CCCTGTGAGACGCAGAATAAC -3'

Sequencing Primer
(F):5'- TAAGGAGGGAGCATTGTGATTG -3'
(R):5'- CTGTTAACAAATGCTTCCACACTG -3'
Posted On 2015-06-12