Mutagenetix > Incidental Mutations

Incidental Mutation 'R4163:Dis3l2'

321588

Institutional Source

Beutler Lab

Gene Symbol

Dis3l2

Ensembl Gene

ENSMUSG00000053333

Gene Name

DIS3 like 3'-5' exoribonuclease 2

Synonyms

4930429A22Rik, 8030493P09Rik

MMRRC Submission

041006-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.342) question?

Stock #

R4163 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86703808-87050095 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 86821237 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 128 (S128G)

Ref Sequence

ENSEMBL: ENSMUSP00000070506 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065694] [ENSMUST00000168237] [ENSMUST00000190618]

AlphaFold

Q8CI75

PDB Structure

Structure of mouse Dis3L2 in complex with oligoU RNA substrate [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000065694
AA Change: S128G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000070506
Gene: ENSMUSG00000053333
AA Change: S128G

Domain	Start	End	E-Value	Type
low complexity region	12	33	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
RNB	369	719	8.9e-140	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000168237
AA Change: S142G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000132673
Gene: ENSMUSG00000053333
AA Change: S142G

Domain	Start	End	E-Value	Type
low complexity region	12	33	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
RNB	383	733	8.9e-140	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189044

Predicted Effect

probably benign
Transcript: ENSMUST00000190618

SMART Domains

Protein: ENSMUSP00000139579
Gene: ENSMUSG00000053333

Domain	Start	End	E-Value	Type
low complexity region	12	33	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
PDB:2VNU\|D	50	123	4e-10	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194093

Meta Mutation Damage Score

0.0594

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar in sequence to 3'/5' exonucleolytic subunits of the RNA exosome. The exosome is a large multimeric ribonucleotide complex responsible for degrading various RNA substrates. Several transcript variants, some protein-coding and some not, have been found for this gene. [provided by RefSeq, Mar 2012]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930539E08Rik	T	C	17: 28,899,529	Y643C	probably benign	Het
4930555F03Rik	G	A	8: 49,495,496		noncoding transcript	Het
Abca8a	C	T	11: 110,050,982	D1154N	probably benign	Het
Adgrf4	A	G	17: 42,667,586	F289L	probably benign	Het
Alkbh2	A	G	5: 114,127,552	L63S	probably damaging	Het
Atp13a4	A	T	16: 29,541,250	N19K	possibly damaging	Het
Birc6	T	A	17: 74,626,980	Y2544N	probably damaging	Het
Bpifa3	A	G	2: 154,135,596	N118S	probably damaging	Het
Chst10	T	A	1: 38,871,823	M87L	probably benign	Het
Cnot9	C	T	1: 74,528,847	P298L	probably damaging	Het
Cops5	T	C	1: 10,030,687	Y228C	probably damaging	Het
Dcaf8	T	G	1: 172,192,570	L492R	probably damaging	Het
Dock1	A	G	7: 134,744,322	R198G	possibly damaging	Het
Elovl7	T	A	13: 108,267,370	M82K	possibly damaging	Het
Fam189a2	G	A	19: 23,975,629	A439V	probably damaging	Het
Fam189a2	C	T	19: 23,975,638	S436N	probably damaging	Het
Fcgr2b	T	C	1: 170,963,447	D259G	possibly damaging	Het
Flnb	A	T	14: 7,915,374	I1502F	possibly damaging	Het
Frk	C	T	10: 34,591,872	P294L	probably damaging	Het
Gkn3	C	T	6: 87,383,525	A163T	probably damaging	Het
Gm128	C	A	3: 95,240,491	R164L	probably benign	Het
Gm2223	C	T	X: 33,505,784		noncoding transcript	Het
Hexdc	C	A	11: 121,221,149	A423E	probably benign	Het
Itgax	G	T	7: 128,144,700	V878F	probably benign	Het
Kank2	A	T	9: 21,795,568	D51E	probably damaging	Het
Kcna4	G	C	2: 107,295,806	W295S	probably damaging	Het
Mfsd12	A	G	10: 81,361,097		probably null	Het
Mis12	A	G	11: 71,025,656	T172A	probably benign	Het
Myo10	T	A	15: 25,726,415		probably null	Het
Myo18a	G	T	11: 77,829,708	R1103L	possibly damaging	Het
Nfix	CAAAAA	CAAAA	8: 84,716,247		probably null	Het
Ntrk2	T	C	13: 58,860,240	V272A	probably damaging	Het
Olfr488	A	T	7: 108,255,832	I102N	probably benign	Het
Olfr58	A	T	9: 19,783,790	Y219F	possibly damaging	Het
Olfr699	A	T	7: 106,790,279	C241S	probably damaging	Het
Pcdh20	C	T	14: 88,468,179	D562N	probably damaging	Het
Prep	T	C	10: 45,067,340	F4L	probably benign	Het
Prep	G	T	10: 45,067,362	R11L	possibly damaging	Het
Ptgs1	C	T	2: 36,251,334	R598C	possibly damaging	Het
Rasgrp1	T	C	2: 117,282,654	D759G	probably benign	Het
Setd5	T	C	6: 113,119,584	S584P	probably benign	Het
Shank3	A	G	15: 89,549,594	D1514G	probably damaging	Het
Shox2	T	C	3: 66,973,771		probably benign	Het
Slc44a5	A	T	3: 154,261,373	R565S	possibly damaging	Het
Slc7a5	A	G	8: 121,888,400	L236S	probably benign	Het
Slfn3	A	T	11: 83,212,770	I156F	probably damaging	Het
Spout1	C	T	2: 30,177,577		probably benign	Het
Trim72	T	C	7: 128,007,908	V203A	probably benign	Het
Vrk2	T	A	11: 26,547,915	I90L	probably benign	Het
Zc3h12c	A	T	9: 52,115,699	Y788N	probably damaging	Het
Zfp831	A	G	2: 174,644,029	T166A	possibly damaging	Het

Other mutations in Dis3l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01382:Dis3l2	APN	1	86857203	missense	probably benign	0.00
IGL01607:Dis3l2	APN	1	86745487	missense	probably benign	0.04
IGL02233:Dis3l2	APN	1	86990231	missense	probably damaging	1.00
IGL02698:Dis3l2	APN	1	87048829	splice site	probably benign
R0514:Dis3l2	UTSW	1	87047092	missense	probably damaging	1.00
R0893:Dis3l2	UTSW	1	87044206	splice site	probably null
R1086:Dis3l2	UTSW	1	86990149	missense	probably benign	0.36
R1140:Dis3l2	UTSW	1	86821438	missense	probably benign	0.00
R1509:Dis3l2	UTSW	1	87021086	missense	possibly damaging	0.91
R2029:Dis3l2	UTSW	1	86854467	splice site	probably benign
R2511:Dis3l2	UTSW	1	86990258	missense	probably benign	0.05
R3772:Dis3l2	UTSW	1	86854408	missense	probably benign
R4547:Dis3l2	UTSW	1	87049671	missense	probably benign	0.00
R4548:Dis3l2	UTSW	1	87049671	missense	probably benign	0.00
R4650:Dis3l2	UTSW	1	86990321	missense	possibly damaging	0.83
R4810:Dis3l2	UTSW	1	87047574	missense	probably damaging	0.99
R4936:Dis3l2	UTSW	1	87044168	missense	probably benign	0.00
R5010:Dis3l2	UTSW	1	86760321	missense	probably benign	0.21
R5040:Dis3l2	UTSW	1	86857337	missense	probably damaging	0.98
R5272:Dis3l2	UTSW	1	86973404	missense	possibly damaging	0.72
R5500:Dis3l2	UTSW	1	87021119	critical splice donor site	probably null
R5556:Dis3l2	UTSW	1	86973404	missense	possibly damaging	0.72
R5772:Dis3l2	UTSW	1	86878432	missense	probably damaging	1.00
R5808:Dis3l2	UTSW	1	87049638	missense	possibly damaging	0.94
R5950:Dis3l2	UTSW	1	87021108	missense	probably damaging	0.96
R6328:Dis3l2	UTSW	1	86854431	missense	probably benign	0.05
R6553:Dis3l2	UTSW	1	86745494	missense	probably damaging	1.00
R6585:Dis3l2	UTSW	1	86745494	missense	probably damaging	1.00
R6905:Dis3l2	UTSW	1	87044839	missense	probably benign	0.00
R6921:Dis3l2	UTSW	1	86857341	missense	probably benign
R7162:Dis3l2	UTSW	1	87044030	missense	possibly damaging	0.94
R7270:Dis3l2	UTSW	1	86990303	missense	possibly damaging	0.49
R7438:Dis3l2	UTSW	1	86745500	critical splice donor site	probably null
R8422:Dis3l2	UTSW	1	86854377	missense	probably benign
R8696:Dis3l2	UTSW	1	86791440	nonsense	probably null
R9235:Dis3l2	UTSW	1	86821339	missense	possibly damaging	0.95
R9291:Dis3l2	UTSW	1	86973493	missense	possibly damaging	0.82
X0027:Dis3l2	UTSW	1	86760351	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- ACTTAGAGTACTAGCCGGGC -3'
(R):5'- CCAAGACTCACCTCTGTCAG -3'

Sequencing Primer
(F):5'- TAGAGTACTAGCCGGGCATTGC -3'
(R):5'- CTCTGTCAGGAGTAGAGATTGAC -3'

Posted On

2015-06-12