Incidental Mutation 'R4163:Fcgr2b'
ID321589
Institutional Source Beutler Lab
Gene Symbol Fcgr2b
Ensembl Gene ENSMUSG00000026656
Gene NameFc receptor, IgG, low affinity IIb
SynonymsFc[g]RII, Ly-m20, F630109E10Rik, CD32, LyM-1, FcgRII, Fcgr2, Fcr-2, Fcgr2a, FcgammaRIIB, Fcr-3, Fc gamma RIIB, Ly-17
MMRRC Submission 041006-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R4163 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location170958617-170976547 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 170963447 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 259 (D259G)
Ref Sequence ENSEMBL: ENSMUSP00000137669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027966] [ENSMUST00000081103] [ENSMUST00000159688] [ENSMUST00000159969]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027966
AA Change: D259G

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000027966
Gene: ENSMUSG00000026656
AA Change: D259G

DomainStartEndE-ValueType
IG 52 125 2.15e-3 SMART
IG 133 211 1.24e-8 SMART
transmembrane domain 224 246 N/A INTRINSIC
low complexity region 277 291 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081103
SMART Domains Protein: ENSMUSP00000079882
Gene: ENSMUSG00000026656

DomainStartEndE-ValueType
IG 52 125 2.15e-3 SMART
IG 133 211 1.24e-8 SMART
transmembrane domain 224 246 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000159688
AA Change: D259G

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000123774
Gene: ENSMUSG00000026656
AA Change: D259G

DomainStartEndE-ValueType
IG 52 125 2.15e-3 SMART
IG 133 211 1.24e-8 SMART
transmembrane domain 224 246 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000159969
AA Change: D259G

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000137669
Gene: ENSMUSG00000026656
AA Change: D259G

DomainStartEndE-ValueType
IG 52 125 2.15e-3 SMART
IG 133 211 1.24e-8 SMART
transmembrane domain 224 246 N/A INTRINSIC
low complexity region 277 291 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160106
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161503
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a low affinity receptor for the Fc region of immunoglobulin gamma complexes. The encoded protein is involved in the phagocytosis of immune complexes and in the regulation of antibody production by B-cells. Variations in this gene may increase susceptibilty to systemic lupus erythematosus (SLE). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mutants show increased antibody response, passive cutaneous analphylaxis, autoantibodies and arthritis susceptibility. On C57BL/6, mice die by 9 months with anemia, proteinuria, glomerulonephritis, and inflammatory disease. A strain variant controls expression in germinal center B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T C 17: 28,899,529 Y643C probably benign Het
4930555F03Rik G A 8: 49,495,496 noncoding transcript Het
Abca8a C T 11: 110,050,982 D1154N probably benign Het
Adgrf4 A G 17: 42,667,586 F289L probably benign Het
Alkbh2 A G 5: 114,127,552 L63S probably damaging Het
Atp13a4 A T 16: 29,541,250 N19K possibly damaging Het
Birc6 T A 17: 74,626,980 Y2544N probably damaging Het
Bpifa3 A G 2: 154,135,596 N118S probably damaging Het
Chst10 T A 1: 38,871,823 M87L probably benign Het
Cnot9 C T 1: 74,528,847 P298L probably damaging Het
Cops5 T C 1: 10,030,687 Y228C probably damaging Het
Dcaf8 T G 1: 172,192,570 L492R probably damaging Het
Dis3l2 A G 1: 86,821,237 S128G probably benign Het
Dock1 A G 7: 134,744,322 R198G possibly damaging Het
Elovl7 T A 13: 108,267,370 M82K possibly damaging Het
Fam189a2 G A 19: 23,975,629 A439V probably damaging Het
Fam189a2 C T 19: 23,975,638 S436N probably damaging Het
Flnb A T 14: 7,915,374 I1502F possibly damaging Het
Frk C T 10: 34,591,872 P294L probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm128 C A 3: 95,240,491 R164L probably benign Het
Gm2223 C T X: 33,505,784 noncoding transcript Het
Hexdc C A 11: 121,221,149 A423E probably benign Het
Itgax G T 7: 128,144,700 V878F probably benign Het
Kank2 A T 9: 21,795,568 D51E probably damaging Het
Kcna4 G C 2: 107,295,806 W295S probably damaging Het
Mfsd12 A G 10: 81,361,097 probably null Het
Mis12 A G 11: 71,025,656 T172A probably benign Het
Myo10 T A 15: 25,726,415 probably null Het
Myo18a G T 11: 77,829,708 R1103L possibly damaging Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Ntrk2 T C 13: 58,860,240 V272A probably damaging Het
Olfr488 A T 7: 108,255,832 I102N probably benign Het
Olfr58 A T 9: 19,783,790 Y219F possibly damaging Het
Olfr699 A T 7: 106,790,279 C241S probably damaging Het
Pcdh20 C T 14: 88,468,179 D562N probably damaging Het
Prep T C 10: 45,067,340 F4L probably benign Het
Prep G T 10: 45,067,362 R11L possibly damaging Het
Ptgs1 C T 2: 36,251,334 R598C possibly damaging Het
Rasgrp1 T C 2: 117,282,654 D759G probably benign Het
Setd5 T C 6: 113,119,584 S584P probably benign Het
Shank3 A G 15: 89,549,594 D1514G probably damaging Het
Shox2 T C 3: 66,973,771 probably benign Het
Slc44a5 A T 3: 154,261,373 R565S possibly damaging Het
Slc7a5 A G 8: 121,888,400 L236S probably benign Het
Slfn3 A T 11: 83,212,770 I156F probably damaging Het
Spout1 C T 2: 30,177,577 probably benign Het
Trim72 T C 7: 128,007,908 V203A probably benign Het
Vrk2 T A 11: 26,547,915 I90L probably benign Het
Zc3h12c A T 9: 52,115,699 Y788N probably damaging Het
Zfp831 A G 2: 174,644,029 T166A possibly damaging Het
Other mutations in Fcgr2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Fcgr2b APN 1 170961230 missense possibly damaging 0.87
IGL01067:Fcgr2b APN 1 170968053 missense possibly damaging 0.52
IGL02557:Fcgr2b APN 1 170963322 splice site probably null
IGL02886:Fcgr2b APN 1 170965728 missense possibly damaging 0.53
R0828:Fcgr2b UTSW 1 170961030 missense probably damaging 1.00
R1344:Fcgr2b UTSW 1 170961081 missense probably damaging 1.00
R1418:Fcgr2b UTSW 1 170961081 missense probably damaging 1.00
R3849:Fcgr2b UTSW 1 170968135 missense possibly damaging 0.49
R4969:Fcgr2b UTSW 1 170963372 missense probably benign 0.29
R5308:Fcgr2b UTSW 1 170965710 missense probably benign 0.02
R5778:Fcgr2b UTSW 1 170963388 missense probably damaging 0.97
R6974:Fcgr2b UTSW 1 170963408 critical splice donor site probably null
R7201:Fcgr2b UTSW 1 170963397 missense probably benign
R7247:Fcgr2b UTSW 1 170965700 critical splice donor site probably null
R8185:Fcgr2b UTSW 1 170966451 missense probably damaging 1.00
R8258:Fcgr2b UTSW 1 170968133 missense possibly damaging 0.93
R8259:Fcgr2b UTSW 1 170968133 missense possibly damaging 0.93
R8372:Fcgr2b UTSW 1 170965761 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGATTTGAGACCCAGCCTTCTC -3'
(R):5'- TGTTTTATGTCACACCTCTGGG -3'

Sequencing Primer
(F):5'- GACCCAGCCTTCTCCCACG -3'
(R):5'- AGTCACTATGGGCTGGAGATG -3'
Posted On2015-06-12