Incidental Mutation 'R4163:Spout1'
ID321591
Institutional Source Beutler Lab
Gene Symbol Spout1
Ensembl Gene ENSMUSG00000039660
Gene NameSPOUT domain containing methyltransferase 1
SynonymsD2Wsu81e
MMRRC Submission 041006-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R4163 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location30173453-30178459 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 30177577 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000097793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015481] [ENSMUST00000100220]
Predicted Effect probably benign
Transcript: ENSMUST00000015481
SMART Domains Protein: ENSMUSP00000015481
Gene: ENSMUSG00000015337

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 30 62 N/A INTRINSIC
Endonuclease_NS 74 282 3.07e-79 SMART
NUC 75 282 3.37e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100220
SMART Domains Protein: ENSMUSP00000097793
Gene: ENSMUSG00000039660

DomainStartEndE-ValueType
coiled coil region 36 72 N/A INTRINSIC
Pfam:Methyltrn_RNA_3 75 365 2.5e-114 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125141
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127309
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142669
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144093
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146466
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (59/59)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality before implantation. Heterozygotes show reduced spontaneous apoptosis of differentiating spermatogonia as well as reduced apoptosis and nuclear DNA fragmentation in splenocytes, thymocytes and MEFs in response to apoptotic stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T C 17: 28,899,529 Y643C probably benign Het
4930555F03Rik G A 8: 49,495,496 noncoding transcript Het
Abca8a C T 11: 110,050,982 D1154N probably benign Het
Adgrf4 A G 17: 42,667,586 F289L probably benign Het
Alkbh2 A G 5: 114,127,552 L63S probably damaging Het
Atp13a4 A T 16: 29,541,250 N19K possibly damaging Het
Birc6 T A 17: 74,626,980 Y2544N probably damaging Het
Bpifa3 A G 2: 154,135,596 N118S probably damaging Het
Chst10 T A 1: 38,871,823 M87L probably benign Het
Cnot9 C T 1: 74,528,847 P298L probably damaging Het
Cops5 T C 1: 10,030,687 Y228C probably damaging Het
Dcaf8 T G 1: 172,192,570 L492R probably damaging Het
Dis3l2 A G 1: 86,821,237 S128G probably benign Het
Dock1 A G 7: 134,744,322 R198G possibly damaging Het
Elovl7 T A 13: 108,267,370 M82K possibly damaging Het
Fam189a2 G A 19: 23,975,629 A439V probably damaging Het
Fam189a2 C T 19: 23,975,638 S436N probably damaging Het
Fcgr2b T C 1: 170,963,447 D259G possibly damaging Het
Flnb A T 14: 7,915,374 I1502F possibly damaging Het
Frk C T 10: 34,591,872 P294L probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm128 C A 3: 95,240,491 R164L probably benign Het
Gm2223 C T X: 33,505,784 noncoding transcript Het
Hexdc C A 11: 121,221,149 A423E probably benign Het
Itgax G T 7: 128,144,700 V878F probably benign Het
Kank2 A T 9: 21,795,568 D51E probably damaging Het
Kcna4 G C 2: 107,295,806 W295S probably damaging Het
Mfsd12 A G 10: 81,361,097 probably null Het
Mis12 A G 11: 71,025,656 T172A probably benign Het
Myo10 T A 15: 25,726,415 probably null Het
Myo18a G T 11: 77,829,708 R1103L possibly damaging Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Ntrk2 T C 13: 58,860,240 V272A probably damaging Het
Olfr488 A T 7: 108,255,832 I102N probably benign Het
Olfr58 A T 9: 19,783,790 Y219F possibly damaging Het
Olfr699 A T 7: 106,790,279 C241S probably damaging Het
Pcdh20 C T 14: 88,468,179 D562N probably damaging Het
Prep T C 10: 45,067,340 F4L probably benign Het
Prep G T 10: 45,067,362 R11L possibly damaging Het
Ptgs1 C T 2: 36,251,334 R598C possibly damaging Het
Rasgrp1 T C 2: 117,282,654 D759G probably benign Het
Setd5 T C 6: 113,119,584 S584P probably benign Het
Shank3 A G 15: 89,549,594 D1514G probably damaging Het
Shox2 T C 3: 66,973,771 probably benign Het
Slc44a5 A T 3: 154,261,373 R565S possibly damaging Het
Slc7a5 A G 8: 121,888,400 L236S probably benign Het
Slfn3 A T 11: 83,212,770 I156F probably damaging Het
Trim72 T C 7: 128,007,908 V203A probably benign Het
Vrk2 T A 11: 26,547,915 I90L probably benign Het
Zc3h12c A T 9: 52,115,699 Y788N probably damaging Het
Zfp831 A G 2: 174,644,029 T166A possibly damaging Het
Other mutations in Spout1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02072:Spout1 APN 2 30177926 nonsense probably null
IGL02232:Spout1 APN 2 30175254 missense probably damaging 1.00
IGL03141:Spout1 APN 2 30175055 missense probably damaging 1.00
R0496:Spout1 UTSW 2 30174971 missense probably benign 0.00
R3847:Spout1 UTSW 2 30177407 splice site probably null
R3944:Spout1 UTSW 2 30174136 missense probably benign
R4162:Spout1 UTSW 2 30177577 intron probably benign
R4164:Spout1 UTSW 2 30177577 intron probably benign
R7922:Spout1 UTSW 2 30176811 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCACACAGAAGATGGTGC -3'
(R):5'- GAACTCTCCTCCCCATGTCAAG -3'

Sequencing Primer
(F):5'- AAGATGGTGCAGGCTCTGGC -3'
(R):5'- GTCAAGTCCTTTCCCTCCAATAATTC -3'
Posted On2015-06-12