Incidental Mutation 'R4163:Kcna4'
ID321593
Institutional Source Beutler Lab
Gene Symbol Kcna4
Ensembl Gene ENSMUSG00000042604
Gene Namepotassium voltage-gated channel, shaker-related subfamily, member 4
SynonymsKv1.4
MMRRC Submission 041006-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4163 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location107290639-107298502 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 107295806 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Serine at position 295 (W295S)
Ref Sequence ENSEMBL: ENSMUSP00000037958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037012]
Predicted Effect probably damaging
Transcript: ENSMUST00000037012
AA Change: W295S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037958
Gene: ENSMUSG00000042604
AA Change: W295S

DomainStartEndE-ValueType
Pfam:K_channel_TID 1 74 1.5e-42 PFAM
low complexity region 77 89 N/A INTRINSIC
coiled coil region 112 139 N/A INTRINSIC
low complexity region 160 166 N/A INTRINSIC
BTB 177 277 1.67e-8 SMART
Pfam:Ion_trans 307 572 2.8e-51 PFAM
Pfam:Ion_trans_2 480 565 9e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173191
Meta Mutation Damage Score 0.9226 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the A-type potassium current class, the members of which may be important in the regulation of the fast repolarizing phase of action potentials in heart and thus may influence the duration of cardiac action potential.[provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and grossly normal; however, a small subset of mutants exhibit spontaneous seizure activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T C 17: 28,899,529 Y643C probably benign Het
4930555F03Rik G A 8: 49,495,496 noncoding transcript Het
Abca8a C T 11: 110,050,982 D1154N probably benign Het
Adgrf4 A G 17: 42,667,586 F289L probably benign Het
Alkbh2 A G 5: 114,127,552 L63S probably damaging Het
Atp13a4 A T 16: 29,541,250 N19K possibly damaging Het
Birc6 T A 17: 74,626,980 Y2544N probably damaging Het
Bpifa3 A G 2: 154,135,596 N118S probably damaging Het
Chst10 T A 1: 38,871,823 M87L probably benign Het
Cnot9 C T 1: 74,528,847 P298L probably damaging Het
Cops5 T C 1: 10,030,687 Y228C probably damaging Het
Dcaf8 T G 1: 172,192,570 L492R probably damaging Het
Dis3l2 A G 1: 86,821,237 S128G probably benign Het
Dock1 A G 7: 134,744,322 R198G possibly damaging Het
Elovl7 T A 13: 108,267,370 M82K possibly damaging Het
Fam189a2 G A 19: 23,975,629 A439V probably damaging Het
Fam189a2 C T 19: 23,975,638 S436N probably damaging Het
Fcgr2b T C 1: 170,963,447 D259G possibly damaging Het
Flnb A T 14: 7,915,374 I1502F possibly damaging Het
Frk C T 10: 34,591,872 P294L probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm128 C A 3: 95,240,491 R164L probably benign Het
Gm2223 C T X: 33,505,784 noncoding transcript Het
Hexdc C A 11: 121,221,149 A423E probably benign Het
Itgax G T 7: 128,144,700 V878F probably benign Het
Kank2 A T 9: 21,795,568 D51E probably damaging Het
Mfsd12 A G 10: 81,361,097 probably null Het
Mis12 A G 11: 71,025,656 T172A probably benign Het
Myo10 T A 15: 25,726,415 probably null Het
Myo18a G T 11: 77,829,708 R1103L possibly damaging Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Ntrk2 T C 13: 58,860,240 V272A probably damaging Het
Olfr488 A T 7: 108,255,832 I102N probably benign Het
Olfr58 A T 9: 19,783,790 Y219F possibly damaging Het
Olfr699 A T 7: 106,790,279 C241S probably damaging Het
Pcdh20 C T 14: 88,468,179 D562N probably damaging Het
Prep T C 10: 45,067,340 F4L probably benign Het
Prep G T 10: 45,067,362 R11L possibly damaging Het
Ptgs1 C T 2: 36,251,334 R598C possibly damaging Het
Rasgrp1 T C 2: 117,282,654 D759G probably benign Het
Setd5 T C 6: 113,119,584 S584P probably benign Het
Shank3 A G 15: 89,549,594 D1514G probably damaging Het
Shox2 T C 3: 66,973,771 probably benign Het
Slc44a5 A T 3: 154,261,373 R565S possibly damaging Het
Slc7a5 A G 8: 121,888,400 L236S probably benign Het
Slfn3 A T 11: 83,212,770 I156F probably damaging Het
Spout1 C T 2: 30,177,577 probably benign Het
Trim72 T C 7: 128,007,908 V203A probably benign Het
Vrk2 T A 11: 26,547,915 I90L probably benign Het
Zc3h12c A T 9: 52,115,699 Y788N probably damaging Het
Zfp831 A G 2: 174,644,029 T166A possibly damaging Het
Other mutations in Kcna4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Kcna4 APN 2 107295862 missense probably damaging 1.00
IGL01025:Kcna4 APN 2 107296391 missense probably damaging 0.99
IGL01433:Kcna4 APN 2 107296733 missense probably damaging 0.99
IGL01805:Kcna4 APN 2 107296498 missense probably damaging 1.00
IGL02121:Kcna4 APN 2 107296618 missense possibly damaging 0.92
Pinched UTSW 2 107296549 missense probably damaging 1.00
PIT4377001:Kcna4 UTSW 2 107296860 missense possibly damaging 0.83
R0255:Kcna4 UTSW 2 107296562 missense probably damaging 1.00
R0650:Kcna4 UTSW 2 107295582 nonsense probably null
R0761:Kcna4 UTSW 2 107296072 missense probably benign 0.02
R1211:Kcna4 UTSW 2 107295315 small deletion probably benign
R1553:Kcna4 UTSW 2 107296687 missense probably benign 0.02
R1854:Kcna4 UTSW 2 107296484 missense probably damaging 1.00
R1915:Kcna4 UTSW 2 107296778 missense probably benign 0.01
R1974:Kcna4 UTSW 2 107296220 missense possibly damaging 0.65
R4002:Kcna4 UTSW 2 107295914 missense probably damaging 1.00
R4413:Kcna4 UTSW 2 107295373 missense probably benign 0.01
R4474:Kcna4 UTSW 2 107296007 missense probably benign
R4492:Kcna4 UTSW 2 107296091 missense probably damaging 1.00
R4525:Kcna4 UTSW 2 107295065 missense possibly damaging 0.93
R4766:Kcna4 UTSW 2 107296543 missense probably damaging 1.00
R4787:Kcna4 UTSW 2 107296468 missense probably damaging 1.00
R5423:Kcna4 UTSW 2 107295806 nonsense probably null
R5725:Kcna4 UTSW 2 107296876 missense possibly damaging 0.48
R6381:Kcna4 UTSW 2 107294972 missense probably benign 0.05
R6399:Kcna4 UTSW 2 107296549 missense probably damaging 1.00
R6787:Kcna4 UTSW 2 107295325 missense possibly damaging 0.91
R6891:Kcna4 UTSW 2 107296307 missense probably damaging 1.00
R7057:Kcna4 UTSW 2 107295320 missense probably damaging 0.96
R7250:Kcna4 UTSW 2 107296318 missense possibly damaging 0.92
R7522:Kcna4 UTSW 2 107296255 missense probably damaging 1.00
R7799:Kcna4 UTSW 2 107295892 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TATTATTACCAGTCAGGAGGCCG -3'
(R):5'- ATTGTGTGCCCTGAGTTCTC -3'

Sequencing Primer
(F):5'- GCCTGAAGAGACCAGTCAATGTC -3'
(R):5'- CCGAGGTGTCATTCAGCAATCTG -3'
Posted On2015-06-12