Incidental Mutation 'R4163:Trim72'
ID321606
Institutional Source Beutler Lab
Gene Symbol Trim72
Ensembl Gene ENSMUSG00000042828
Gene Nametripartite motif-containing 72
Synonymsmitsugumin 53, MG53
MMRRC Submission 041006-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R4163 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location128003949-128011033 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128007908 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 203 (V203A)
Ref Sequence ENSEMBL: ENSMUSP00000101855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081042] [ENSMUST00000106248]
Predicted Effect probably benign
Transcript: ENSMUST00000081042
AA Change: V203A

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000079832
Gene: ENSMUSG00000042828
AA Change: V203A

DomainStartEndE-ValueType
RING 14 56 5.14e-7 SMART
BBOX 81 122 3.89e-7 SMART
coiled coil region 135 169 N/A INTRINSIC
coiled coil region 204 232 N/A INTRINSIC
PRY 288 341 6.48e-13 SMART
Pfam:SPRY 342 472 4.9e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106248
AA Change: V203A

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000101855
Gene: ENSMUSG00000042828
AA Change: V203A

DomainStartEndE-ValueType
RING 14 56 5.14e-7 SMART
BBOX 81 122 3.89e-7 SMART
coiled coil region 135 169 N/A INTRINSIC
coiled coil region 204 232 N/A INTRINSIC
PRY 288 341 6.48e-13 SMART
Pfam:SPRY 344 465 1.7e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126205
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206216
Meta Mutation Damage Score 0.0785 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (59/59)
MGI Phenotype PHENOTYPE: Mice with disruption of this gene display muscle pathologies that develop with age. Mice homozygous for a knock-out allele exhibit enhanced myogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T C 17: 28,899,529 Y643C probably benign Het
4930555F03Rik G A 8: 49,495,496 noncoding transcript Het
Abca8a C T 11: 110,050,982 D1154N probably benign Het
Adgrf4 A G 17: 42,667,586 F289L probably benign Het
Alkbh2 A G 5: 114,127,552 L63S probably damaging Het
Atp13a4 A T 16: 29,541,250 N19K possibly damaging Het
Birc6 T A 17: 74,626,980 Y2544N probably damaging Het
Bpifa3 A G 2: 154,135,596 N118S probably damaging Het
Chst10 T A 1: 38,871,823 M87L probably benign Het
Cnot9 C T 1: 74,528,847 P298L probably damaging Het
Cops5 T C 1: 10,030,687 Y228C probably damaging Het
Dcaf8 T G 1: 172,192,570 L492R probably damaging Het
Dis3l2 A G 1: 86,821,237 S128G probably benign Het
Dock1 A G 7: 134,744,322 R198G possibly damaging Het
Elovl7 T A 13: 108,267,370 M82K possibly damaging Het
Fam189a2 G A 19: 23,975,629 A439V probably damaging Het
Fam189a2 C T 19: 23,975,638 S436N probably damaging Het
Fcgr2b T C 1: 170,963,447 D259G possibly damaging Het
Flnb A T 14: 7,915,374 I1502F possibly damaging Het
Frk C T 10: 34,591,872 P294L probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm128 C A 3: 95,240,491 R164L probably benign Het
Gm2223 C T X: 33,505,784 noncoding transcript Het
Hexdc C A 11: 121,221,149 A423E probably benign Het
Itgax G T 7: 128,144,700 V878F probably benign Het
Kank2 A T 9: 21,795,568 D51E probably damaging Het
Kcna4 G C 2: 107,295,806 W295S probably damaging Het
Mfsd12 A G 10: 81,361,097 probably null Het
Mis12 A G 11: 71,025,656 T172A probably benign Het
Myo10 T A 15: 25,726,415 probably null Het
Myo18a G T 11: 77,829,708 R1103L possibly damaging Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Ntrk2 T C 13: 58,860,240 V272A probably damaging Het
Olfr488 A T 7: 108,255,832 I102N probably benign Het
Olfr58 A T 9: 19,783,790 Y219F possibly damaging Het
Olfr699 A T 7: 106,790,279 C241S probably damaging Het
Pcdh20 C T 14: 88,468,179 D562N probably damaging Het
Prep T C 10: 45,067,340 F4L probably benign Het
Prep G T 10: 45,067,362 R11L possibly damaging Het
Ptgs1 C T 2: 36,251,334 R598C possibly damaging Het
Rasgrp1 T C 2: 117,282,654 D759G probably benign Het
Setd5 T C 6: 113,119,584 S584P probably benign Het
Shank3 A G 15: 89,549,594 D1514G probably damaging Het
Shox2 T C 3: 66,973,771 probably benign Het
Slc44a5 A T 3: 154,261,373 R565S possibly damaging Het
Slc7a5 A G 8: 121,888,400 L236S probably benign Het
Slfn3 A T 11: 83,212,770 I156F probably damaging Het
Spout1 C T 2: 30,177,577 probably benign Het
Vrk2 T A 11: 26,547,915 I90L probably benign Het
Zc3h12c A T 9: 52,115,699 Y788N probably damaging Het
Zfp831 A G 2: 174,644,029 T166A possibly damaging Het
Other mutations in Trim72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02195:Trim72 APN 7 128007964 missense probably damaging 0.97
IGL02538:Trim72 APN 7 128004770 missense probably damaging 1.00
IGL02794:Trim72 APN 7 128004532 missense probably damaging 1.00
IGL03077:Trim72 APN 7 128007841 missense probably benign
H8786:Trim72 UTSW 7 128004791 missense probably damaging 0.99
R1101:Trim72 UTSW 7 128010247 missense possibly damaging 0.94
R1711:Trim72 UTSW 7 128004585 missense probably damaging 1.00
R1826:Trim72 UTSW 7 128007844 missense possibly damaging 0.59
R1853:Trim72 UTSW 7 128009082 missense probably benign 0.01
R1854:Trim72 UTSW 7 128009082 missense probably benign 0.01
R2513:Trim72 UTSW 7 128004706 missense possibly damaging 0.93
R4587:Trim72 UTSW 7 128007992 missense probably benign 0.21
R5027:Trim72 UTSW 7 128007965 missense probably damaging 0.99
R5067:Trim72 UTSW 7 128009967 missense possibly damaging 0.86
R5276:Trim72 UTSW 7 128004542 missense probably damaging 1.00
R5290:Trim72 UTSW 7 128010004 missense probably benign 0.03
R5339:Trim72 UTSW 7 128010333 missense probably benign
R5410:Trim72 UTSW 7 128009923 missense probably damaging 1.00
R6301:Trim72 UTSW 7 128004614 missense possibly damaging 0.93
R6594:Trim72 UTSW 7 128010048 missense probably damaging 1.00
R6774:Trim72 UTSW 7 128010386 missense probably damaging 1.00
R7162:Trim72 UTSW 7 128007649 missense probably benign 0.18
R7372:Trim72 UTSW 7 128004686 missense possibly damaging 0.63
R7937:Trim72 UTSW 7 128010319 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGAAGACTGTAGCGGTGCTG -3'
(R):5'- CCCTGAACAATGTGACAATGG -3'

Sequencing Primer
(F):5'- AGAACCCTGGGACTGTAGGTC -3'
(R):5'- CCTGAACAATGTGACAATGGGATGAG -3'
Posted On2015-06-12