Incidental Mutation 'R4163:Dock1'
ID321608
Institutional Source Beutler Lab
Gene Symbol Dock1
Ensembl Gene ENSMUSG00000058325
Gene Namededicator of cytokinesis 1
SynonymsD630004B07Rik, Dock180, 9130006G06Rik
MMRRC Submission 041006-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4163 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location134670654-135173639 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 134744322 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 198 (R198G)
Ref Sequence ENSEMBL: ENSMUSP00000147945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084488] [ENSMUST00000211593]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084488
AA Change: R198G

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000081531
Gene: ENSMUSG00000058325
AA Change: R198G

DomainStartEndE-ValueType
SH3 12 69 7.57e-17 SMART
Pfam:DOCK_N 72 416 1.7e-113 PFAM
Pfam:DOCK-C2 421 618 1.2e-61 PFAM
low complexity region 628 639 N/A INTRINSIC
Pfam:DHR-2 1111 1610 3.3e-102 PFAM
low complexity region 1639 1664 N/A INTRINSIC
low complexity region 1683 1701 N/A INTRINSIC
low complexity region 1756 1773 N/A INTRINSIC
low complexity region 1823 1857 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210464
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210617
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211570
Predicted Effect possibly damaging
Transcript: ENSMUST00000211593
AA Change: R198G

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
Meta Mutation Damage Score 0.2726 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Dedicator of cytokinesis proteins act as guanine nucleotide exchange factors for small Rho family G proteins. The encoded protein regulates the small GTPase Rac, thereby influencing several biological processes, including phagocytosis and cell migration. Overexpression of this gene has also been associated with certain cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality associated with abnormal muscle development and failure of lungs to inflate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T C 17: 28,899,529 Y643C probably benign Het
4930555F03Rik G A 8: 49,495,496 noncoding transcript Het
Abca8a C T 11: 110,050,982 D1154N probably benign Het
Adgrf4 A G 17: 42,667,586 F289L probably benign Het
Alkbh2 A G 5: 114,127,552 L63S probably damaging Het
Atp13a4 A T 16: 29,541,250 N19K possibly damaging Het
Birc6 T A 17: 74,626,980 Y2544N probably damaging Het
Bpifa3 A G 2: 154,135,596 N118S probably damaging Het
Chst10 T A 1: 38,871,823 M87L probably benign Het
Cnot9 C T 1: 74,528,847 P298L probably damaging Het
Cops5 T C 1: 10,030,687 Y228C probably damaging Het
Dcaf8 T G 1: 172,192,570 L492R probably damaging Het
Dis3l2 A G 1: 86,821,237 S128G probably benign Het
Elovl7 T A 13: 108,267,370 M82K possibly damaging Het
Fam189a2 G A 19: 23,975,629 A439V probably damaging Het
Fam189a2 C T 19: 23,975,638 S436N probably damaging Het
Fcgr2b T C 1: 170,963,447 D259G possibly damaging Het
Flnb A T 14: 7,915,374 I1502F possibly damaging Het
Frk C T 10: 34,591,872 P294L probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm128 C A 3: 95,240,491 R164L probably benign Het
Gm2223 C T X: 33,505,784 noncoding transcript Het
Hexdc C A 11: 121,221,149 A423E probably benign Het
Itgax G T 7: 128,144,700 V878F probably benign Het
Kank2 A T 9: 21,795,568 D51E probably damaging Het
Kcna4 G C 2: 107,295,806 W295S probably damaging Het
Mfsd12 A G 10: 81,361,097 probably null Het
Mis12 A G 11: 71,025,656 T172A probably benign Het
Myo10 T A 15: 25,726,415 probably null Het
Myo18a G T 11: 77,829,708 R1103L possibly damaging Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Ntrk2 T C 13: 58,860,240 V272A probably damaging Het
Olfr488 A T 7: 108,255,832 I102N probably benign Het
Olfr58 A T 9: 19,783,790 Y219F possibly damaging Het
Olfr699 A T 7: 106,790,279 C241S probably damaging Het
Pcdh20 C T 14: 88,468,179 D562N probably damaging Het
Prep T C 10: 45,067,340 F4L probably benign Het
Prep G T 10: 45,067,362 R11L possibly damaging Het
Ptgs1 C T 2: 36,251,334 R598C possibly damaging Het
Rasgrp1 T C 2: 117,282,654 D759G probably benign Het
Setd5 T C 6: 113,119,584 S584P probably benign Het
Shank3 A G 15: 89,549,594 D1514G probably damaging Het
Shox2 T C 3: 66,973,771 probably benign Het
Slc44a5 A T 3: 154,261,373 R565S possibly damaging Het
Slc7a5 A G 8: 121,888,400 L236S probably benign Het
Slfn3 A T 11: 83,212,770 I156F probably damaging Het
Spout1 C T 2: 30,177,577 probably benign Het
Trim72 T C 7: 128,007,908 V203A probably benign Het
Vrk2 T A 11: 26,547,915 I90L probably benign Het
Zc3h12c A T 9: 52,115,699 Y788N probably damaging Het
Zfp831 A G 2: 174,644,029 T166A possibly damaging Het
Other mutations in Dock1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Dock1 APN 7 135146531 splice site probably benign
IGL01319:Dock1 APN 7 134789278 missense probably benign
IGL01390:Dock1 APN 7 134745047 missense possibly damaging 0.95
IGL01394:Dock1 APN 7 134766216 missense probably benign 0.01
IGL01489:Dock1 APN 7 134999321 splice site probably benign
IGL01505:Dock1 APN 7 135158510 missense possibly damaging 0.91
IGL01586:Dock1 APN 7 134753377 missense probably damaging 1.00
IGL01637:Dock1 APN 7 135137813 critical splice acceptor site probably null
IGL01649:Dock1 APN 7 134777410 missense probably damaging 1.00
IGL01652:Dock1 APN 7 134777497 splice site probably benign
IGL01859:Dock1 APN 7 135077161 missense possibly damaging 0.51
IGL02068:Dock1 APN 7 134771548 missense probably benign 0.26
IGL02168:Dock1 APN 7 135077131 splice site probably benign
IGL02200:Dock1 APN 7 134744271 missense probably benign 0.01
IGL02244:Dock1 APN 7 134777445 nonsense probably null
IGL02285:Dock1 APN 7 135081920 critical splice donor site probably null
IGL02319:Dock1 APN 7 134772449 missense possibly damaging 0.94
IGL02334:Dock1 APN 7 135145565 missense probably damaging 1.00
IGL02338:Dock1 APN 7 135133075 missense possibly damaging 0.95
IGL02351:Dock1 APN 7 135108819 missense possibly damaging 0.51
IGL02358:Dock1 APN 7 135108819 missense possibly damaging 0.51
IGL02607:Dock1 APN 7 134851513 missense probably benign 0.13
IGL02638:Dock1 APN 7 135146480 missense probably benign 0.09
IGL02724:Dock1 APN 7 135163353 missense probably benign
IGL02820:Dock1 APN 7 135167215 missense probably benign 0.11
IGL02950:Dock1 APN 7 134730024 missense probably damaging 1.00
IGL02993:Dock1 APN 7 134744298 missense probably benign
IGL03000:Dock1 APN 7 134789240 missense probably benign 0.17
IGL03092:Dock1 APN 7 134765216 splice site probably benign
IGL03131:Dock1 APN 7 134874183 missense possibly damaging 0.80
IGL03136:Dock1 APN 7 135168389 missense probably benign 0.00
IGL03210:Dock1 APN 7 134756939 missense possibly damaging 0.62
IGL03220:Dock1 APN 7 135108522 critical splice donor site probably null
P0028:Dock1 UTSW 7 134999324 splice site probably benign
PIT4453001:Dock1 UTSW 7 135152300 missense probably benign
R0003:Dock1 UTSW 7 134730064 splice site probably benign
R0058:Dock1 UTSW 7 135108761 missense possibly damaging 0.65
R0058:Dock1 UTSW 7 135108761 missense possibly damaging 0.65
R0062:Dock1 UTSW 7 134777495 splice site probably null
R0062:Dock1 UTSW 7 134777495 splice site probably null
R0179:Dock1 UTSW 7 135098837 missense probably damaging 0.99
R0180:Dock1 UTSW 7 135098837 missense probably damaging 0.99
R0347:Dock1 UTSW 7 134763867 missense probably damaging 1.00
R0399:Dock1 UTSW 7 135163442 missense probably benign 0.00
R0457:Dock1 UTSW 7 135138145 missense possibly damaging 0.90
R0480:Dock1 UTSW 7 134737718 missense probably damaging 1.00
R0521:Dock1 UTSW 7 135143778 missense probably benign 0.21
R0792:Dock1 UTSW 7 134874150 missense probably benign 0.02
R1136:Dock1 UTSW 7 134848173 missense possibly damaging 0.95
R1224:Dock1 UTSW 7 135108819 missense possibly damaging 0.67
R1267:Dock1 UTSW 7 134746436 missense probably damaging 1.00
R1373:Dock1 UTSW 7 135167175 missense probably benign 0.01
R1401:Dock1 UTSW 7 135133936 nonsense probably null
R1454:Dock1 UTSW 7 134851609 splice site probably benign
R1465:Dock1 UTSW 7 134782409 missense probably benign 0.00
R1465:Dock1 UTSW 7 134782409 missense probably benign 0.00
R1523:Dock1 UTSW 7 134744247 missense possibly damaging 0.49
R1643:Dock1 UTSW 7 135098779 missense probably damaging 1.00
R1659:Dock1 UTSW 7 134789243 missense probably damaging 0.98
R1793:Dock1 UTSW 7 135098727 splice site probably null
R1864:Dock1 UTSW 7 135146507 missense probably benign 0.07
R1911:Dock1 UTSW 7 134999300 missense probably damaging 1.00
R2567:Dock1 UTSW 7 135145484 missense probably damaging 1.00
R3816:Dock1 UTSW 7 134744286 nonsense probably null
R3971:Dock1 UTSW 7 134746908 missense probably damaging 1.00
R4063:Dock1 UTSW 7 135115292 missense possibly damaging 0.81
R4271:Dock1 UTSW 7 134734054 missense probably damaging 0.99
R4684:Dock1 UTSW 7 134724409 nonsense probably null
R4717:Dock1 UTSW 7 134848170 missense probably damaging 1.00
R4725:Dock1 UTSW 7 134745014 nonsense probably null
R4788:Dock1 UTSW 7 135145484 missense probably damaging 0.98
R4869:Dock1 UTSW 7 134734071 missense probably damaging 1.00
R4889:Dock1 UTSW 7 134744976 missense probably benign 0.02
R4953:Dock1 UTSW 7 135152288 missense probably benign 0.34
R5031:Dock1 UTSW 7 135152246 missense probably benign 0.02
R5161:Dock1 UTSW 7 134734062 missense possibly damaging 0.69
R5168:Dock1 UTSW 7 135118908 missense probably damaging 1.00
R5212:Dock1 UTSW 7 134789194 missense possibly damaging 0.68
R5648:Dock1 UTSW 7 134746954 missense probably damaging 1.00
R5685:Dock1 UTSW 7 134772362 missense probably benign 0.19
R5834:Dock1 UTSW 7 134763933 missense probably damaging 1.00
R6181:Dock1 UTSW 7 135158522 missense probably damaging 1.00
R6334:Dock1 UTSW 7 134851576 missense probably benign 0.01
R6406:Dock1 UTSW 7 135145486 missense probably benign 0.26
R6425:Dock1 UTSW 7 135163381 missense possibly damaging 0.79
R6489:Dock1 UTSW 7 134990541 missense probably damaging 0.99
R6616:Dock1 UTSW 7 135108492 missense possibly damaging 0.85
R6706:Dock1 UTSW 7 135133886 missense possibly damaging 0.72
R6766:Dock1 UTSW 7 134756793 intron probably null
R6861:Dock1 UTSW 7 134771478 missense probably benign 0.00
R6985:Dock1 UTSW 7 135163403 missense possibly damaging 0.95
R7259:Dock1 UTSW 7 134782748 missense probably damaging 0.99
R7285:Dock1 UTSW 7 134745008 missense probably benign 0.01
R7471:Dock1 UTSW 7 135163343 missense possibly damaging 0.65
R7497:Dock1 UTSW 7 134765274 missense probably benign
R7691:Dock1 UTSW 7 135138157 critical splice donor site probably null
R7732:Dock1 UTSW 7 134744970 missense probably benign 0.01
X0062:Dock1 UTSW 7 135108451 missense probably damaging 1.00
Z1088:Dock1 UTSW 7 134804547 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGCATTTCATCTGCTCTGTG -3'
(R):5'- TGAAACACGCTGGACACTTG -3'

Sequencing Primer
(F):5'- TGACACTGTGCTAGGGGAC -3'
(R):5'- AGTGTCAATTCTGGACTTCCTTAAC -3'
Posted On2015-06-12