Incidental Mutation 'R0398:Ptchd4'
ID32162
Institutional Source Beutler Lab
Gene Symbol Ptchd4
Ensembl Gene ENSMUSG00000042256
Gene Namepatched domain containing 4
Synonyms3110082D06Rik
MMRRC Submission 038603-MU
Accession Numbers

Ncbi RefSeq: NM_028474.1; MGI: 1920485

Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R0398 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location42315947-42507741 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42377259 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 231 (T231A)
Ref Sequence ENSEMBL: ENSMUSP00000047640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048691]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048691
AA Change: T231A

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000047640
Gene: ENSMUSG00000042256
AA Change: T231A

DomainStartEndE-ValueType
Pfam:Patched 58 867 6.1e-102 PFAM
Pfam:Sterol-sensing 312 464 2.9e-26 PFAM
low complexity region 869 891 N/A INTRINSIC
Meta Mutation Damage Score 0.1551 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 93.8%
  • 20x: 83.2%
Validation Efficiency 100% (81/81)
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A G 5: 9,445,367 R724G probably benign Het
Abcb11 T C 2: 69,286,666 Q546R probably null Het
Acr T G 15: 89,573,941 V275G probably damaging Het
Adam5 A G 8: 24,813,432 Y160H probably benign Het
Adcy5 T A 16: 35,269,068 M545K probably damaging Het
Aoc2 A G 11: 101,325,553 E154G possibly damaging Het
Atg2a T G 19: 6,246,578 L338R probably damaging Het
Atp2a1 T C 7: 126,450,418 probably benign Het
Bbs7 A G 3: 36,590,717 S436P probably benign Het
Bpnt1 T C 1: 185,338,158 Y16H probably benign Het
Cbll1 A T 12: 31,492,092 F90Y probably damaging Het
Cbs G T 17: 31,617,242 Q411K probably benign Het
Cdca2 A C 14: 67,697,962 F435V probably damaging Het
Cdh13 T G 8: 119,314,047 S664A probably damaging Het
Cdk17 T A 10: 93,237,840 V438E probably benign Het
Cep295 T C 9: 15,354,736 D40G possibly damaging Het
Col6a1 T C 10: 76,710,118 H840R unknown Het
Cpa1 A G 6: 30,645,251 T409A probably benign Het
Crlf1 G A 8: 70,499,089 probably benign Het
E2f2 T A 4: 136,180,544 I184N probably damaging Het
Ehbp1 T C 11: 22,095,886 D596G probably damaging Het
Ets2 A G 16: 95,716,223 Y333C probably damaging Het
Fam178b A G 1: 36,632,406 probably benign Het
Fndc3b A G 3: 27,461,779 V626A probably benign Het
Gart G T 16: 91,639,449 A140E probably damaging Het
Gbp7 T C 3: 142,545,513 S477P possibly damaging Het
Gm16380 T C 9: 53,884,169 noncoding transcript Het
Hmcn1 C A 1: 150,798,814 R579M possibly damaging Het
Hoxb8 A C 11: 96,283,111 H50P probably damaging Het
Hspa4 C T 11: 53,272,879 probably null Het
Hspa4l G A 3: 40,756,997 probably benign Het
Hyal4 A T 6: 24,756,671 Y296F probably damaging Het
Igsf8 C A 1: 172,317,499 T131K probably damaging Het
Ilvbl C T 10: 78,579,539 P298L probably damaging Het
Jak2 T A 19: 29,282,388 I229N possibly damaging Het
Kif1b T C 4: 149,204,231 D1205G possibly damaging Het
Lrrc63 T C 14: 75,126,470 R74G probably benign Het
Lvrn A G 18: 46,880,693 T481A probably benign Het
Macf1 T A 4: 123,351,017 T7312S probably damaging Het
Magel2 C T 7: 62,380,551 Q1068* probably null Het
Mrpl3 A G 9: 105,064,103 Y203C probably damaging Het
Nek2 T A 1: 191,827,361 I326N probably benign Het
Nlrc4 A C 17: 74,445,920 N489K probably damaging Het
Nlrp4f A T 13: 65,194,918 S304R possibly damaging Het
Ogfr C G 2: 180,593,699 R189G probably damaging Het
Olfr1151 A T 2: 87,858,057 N294I probably damaging Het
Olfr506 T A 7: 108,612,955 I216N probably benign Het
Olfr548-ps1 T A 7: 102,542,692 L252H probably damaging Het
Orm3 A G 4: 63,357,648 S145G probably benign Het
Pclo A G 5: 14,681,702 E3406G unknown Het
Pcx T G 19: 4,601,610 F4C probably benign Het
Pgd C A 4: 149,153,882 G364V probably damaging Het
Pla2g12a C A 3: 129,890,396 D102E probably benign Het
Pnpo A T 11: 96,942,427 C82* probably null Het
Prdm1 T C 10: 44,439,809 N792S probably damaging Het
Prim2 A T 1: 33,484,676 probably benign Het
Proca1 C A 11: 78,205,268 P242Q probably benign Het
Psmc5 A G 11: 106,261,544 N129S probably benign Het
Qrfpr C T 3: 36,181,052 probably benign Het
Rab44 G A 17: 29,145,370 probably benign Het
Racgap1 T C 15: 99,628,627 probably benign Het
Rapgef4 A G 2: 72,031,041 E25G probably damaging Het
Rpl8 G C 15: 76,905,046 probably benign Het
Samd12 G A 15: 53,719,720 P73S possibly damaging Het
Samd9l T A 6: 3,374,502 N920Y probably damaging Het
Sdk1 T C 5: 141,962,721 V607A probably benign Het
Slc25a19 A G 11: 115,617,575 Y196H probably damaging Het
Slc39a3 A T 10: 81,033,787 M12K possibly damaging Het
Slc5a4a T C 10: 76,182,722 I501T possibly damaging Het
Sp4 A T 12: 118,298,673 V546D possibly damaging Het
Ssh3 C T 19: 4,263,699 V511M possibly damaging Het
Stard9 T G 2: 120,696,307 V1015G probably benign Het
Thoc5 G T 11: 4,921,978 V516F possibly damaging Het
Ttc21a T A 9: 119,954,562 I570N probably damaging Het
Ttc4 T C 4: 106,667,573 probably null Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Yipf3 A G 17: 46,251,485 E298G possibly damaging Het
Zbtb34 C A 2: 33,411,048 E494* probably null Het
Zfhx3 A G 8: 108,951,246 Y2976C probably damaging Het
Other mutations in Ptchd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Ptchd4 APN 17 42316926 nonsense probably null
IGL01360:Ptchd4 APN 17 42317045 missense probably benign 0.09
IGL01814:Ptchd4 APN 17 42503286 missense possibly damaging 0.84
IGL01885:Ptchd4 APN 17 42503602 missense probably damaging 1.00
IGL01929:Ptchd4 APN 17 42503322 missense probably benign 0.02
IGL02371:Ptchd4 APN 17 42316974 missense possibly damaging 0.83
IGL02480:Ptchd4 APN 17 42502540 missense probably benign 0.38
IGL02507:Ptchd4 APN 17 42316873 missense possibly damaging 0.72
IGL02593:Ptchd4 APN 17 42317146 missense probably benign 0.24
IGL02861:Ptchd4 APN 17 42377317 missense probably damaging 1.00
IGL02884:Ptchd4 APN 17 42502449 missense possibly damaging 0.86
IGL03384:Ptchd4 APN 17 42502590 missense probably damaging 1.00
PIT4418001:Ptchd4 UTSW 17 42503089 missense probably damaging 1.00
R0030:Ptchd4 UTSW 17 42317108 nonsense probably null
R0243:Ptchd4 UTSW 17 42503416 missense probably damaging 1.00
R0513:Ptchd4 UTSW 17 42503746 missense probably benign 0.14
R0630:Ptchd4 UTSW 17 42377185 missense probably benign 0.17
R0662:Ptchd4 UTSW 17 42502576 missense probably damaging 1.00
R1004:Ptchd4 UTSW 17 42377602 missense probably benign 0.00
R1433:Ptchd4 UTSW 17 42503715 missense possibly damaging 0.75
R1451:Ptchd4 UTSW 17 42502918 missense probably damaging 0.99
R1522:Ptchd4 UTSW 17 42503542 missense probably damaging 1.00
R1901:Ptchd4 UTSW 17 42503616 missense probably benign 0.10
R1902:Ptchd4 UTSW 17 42503616 missense probably benign 0.10
R2135:Ptchd4 UTSW 17 42317074 missense probably benign 0.01
R3935:Ptchd4 UTSW 17 42503489 missense possibly damaging 0.80
R4184:Ptchd4 UTSW 17 42502759 missense probably damaging 0.99
R4552:Ptchd4 UTSW 17 42502455 missense probably benign 0.00
R4573:Ptchd4 UTSW 17 42502777 missense probably benign 0.26
R5100:Ptchd4 UTSW 17 42503676 missense possibly damaging 0.59
R5640:Ptchd4 UTSW 17 42503135 missense possibly damaging 0.73
R6213:Ptchd4 UTSW 17 42377360 missense probably benign 0.00
R6704:Ptchd4 UTSW 17 42317040 missense probably benign 0.00
R7011:Ptchd4 UTSW 17 42503868 missense probably benign 0.19
R7017:Ptchd4 UTSW 17 42502735 missense probably damaging 1.00
R7185:Ptchd4 UTSW 17 42503188 missense probably damaging 1.00
R8112:Ptchd4 UTSW 17 42503175 missense probably benign 0.25
R8153:Ptchd4 UTSW 17 42503896 missense probably benign 0.31
R8220:Ptchd4 UTSW 17 42502663 missense probably benign 0.00
X0062:Ptchd4 UTSW 17 42377464 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCCATGTAGCTCCAAGAGGTTGAG -3'
(R):5'- TGGAAATGCAGACCGTGAGCAC -3'

Sequencing Primer
(F):5'- GTTGAGACTAAAAGCCTGACTTTCC -3'
(R):5'- TCAGGATCAGCACTAGGCTC -3'
Posted On2013-04-24