Incidental Mutation 'R4163:Slfn3'
ID321623
Institutional Source Beutler Lab
Gene Symbol Slfn3
Ensembl Gene ENSMUSG00000018986
Gene Nameschlafen 3
Synonyms
MMRRC Submission 041006-MU
Accession Numbers

MGI: 1329005

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4163 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location83191330-83215154 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 83212770 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 156 (I156F)
Ref Sequence ENSEMBL: ENSMUSP00000150425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019130] [ENSMUST00000214041]
Predicted Effect probably damaging
Transcript: ENSMUST00000019130
AA Change: I33F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000019130
Gene: ENSMUSG00000018986
AA Change: I33F

DomainStartEndE-ValueType
Pfam:AlbA_2 165 303 5.5e-11 PFAM
low complexity region 394 412 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000214041
AA Change: I156F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216599
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (59/59)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit normal immune cell populations. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T C 17: 28,899,529 Y643C probably benign Het
4930555F03Rik G A 8: 49,495,496 noncoding transcript Het
Abca8a C T 11: 110,050,982 D1154N probably benign Het
Adgrf4 A G 17: 42,667,586 F289L probably benign Het
Alkbh2 A G 5: 114,127,552 L63S probably damaging Het
Atp13a4 A T 16: 29,541,250 N19K possibly damaging Het
Birc6 T A 17: 74,626,980 Y2544N probably damaging Het
Bpifa3 A G 2: 154,135,596 N118S probably damaging Het
Chst10 T A 1: 38,871,823 M87L probably benign Het
Cnot9 C T 1: 74,528,847 P298L probably damaging Het
Cops5 T C 1: 10,030,687 Y228C probably damaging Het
Dcaf8 T G 1: 172,192,570 L492R probably damaging Het
Dis3l2 A G 1: 86,821,237 S128G probably benign Het
Dock1 A G 7: 134,744,322 R198G possibly damaging Het
Elovl7 T A 13: 108,267,370 M82K possibly damaging Het
Fam189a2 G A 19: 23,975,629 A439V probably damaging Het
Fam189a2 C T 19: 23,975,638 S436N probably damaging Het
Fcgr2b T C 1: 170,963,447 D259G possibly damaging Het
Flnb A T 14: 7,915,374 I1502F possibly damaging Het
Frk C T 10: 34,591,872 P294L probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm128 C A 3: 95,240,491 R164L probably benign Het
Gm2223 C T X: 33,505,784 noncoding transcript Het
Hexdc C A 11: 121,221,149 A423E probably benign Het
Itgax G T 7: 128,144,700 V878F probably benign Het
Kank2 A T 9: 21,795,568 D51E probably damaging Het
Kcna4 G C 2: 107,295,806 W295S probably damaging Het
Mfsd12 A G 10: 81,361,097 probably null Het
Mis12 A G 11: 71,025,656 T172A probably benign Het
Myo10 T A 15: 25,726,415 probably null Het
Myo18a G T 11: 77,829,708 R1103L possibly damaging Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Ntrk2 T C 13: 58,860,240 V272A probably damaging Het
Olfr488 A T 7: 108,255,832 I102N probably benign Het
Olfr58 A T 9: 19,783,790 Y219F possibly damaging Het
Olfr699 A T 7: 106,790,279 C241S probably damaging Het
Pcdh20 C T 14: 88,468,179 D562N probably damaging Het
Prep G T 10: 45,067,362 R11L possibly damaging Het
Prep T C 10: 45,067,340 F4L probably benign Het
Ptgs1 C T 2: 36,251,334 R598C possibly damaging Het
Rasgrp1 T C 2: 117,282,654 D759G probably benign Het
Setd5 T C 6: 113,119,584 S584P probably benign Het
Shank3 A G 15: 89,549,594 D1514G probably damaging Het
Shox2 T C 3: 66,973,771 probably benign Het
Slc44a5 A T 3: 154,261,373 R565S possibly damaging Het
Slc7a5 A G 8: 121,888,400 L236S probably benign Het
Spout1 C T 2: 30,177,577 probably benign Het
Trim72 T C 7: 128,007,908 V203A probably benign Het
Vrk2 T A 11: 26,547,915 I90L probably benign Het
Zc3h12c A T 9: 52,115,699 Y788N probably damaging Het
Zfp831 A G 2: 174,644,029 T166A possibly damaging Het
Other mutations in Slfn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Slfn3 APN 11 83213431 missense probably damaging 1.00
IGL01405:Slfn3 APN 11 83214716 missense possibly damaging 0.90
IGL01631:Slfn3 APN 11 83213535 missense probably damaging 0.99
IGL01944:Slfn3 APN 11 83213148 missense possibly damaging 0.59
IGL02354:Slfn3 APN 11 83213242 missense possibly damaging 0.95
IGL02361:Slfn3 APN 11 83213242 missense possibly damaging 0.95
IGL02512:Slfn3 APN 11 83213025 missense possibly damaging 0.55
IGL02875:Slfn3 APN 11 83213427 missense probably damaging 0.98
IGL02944:Slfn3 APN 11 83213011 missense probably damaging 0.99
IGL03402:Slfn3 APN 11 83213431 missense probably damaging 1.00
R0452:Slfn3 UTSW 11 83213128 missense possibly damaging 0.87
R0506:Slfn3 UTSW 11 83213160 missense probably damaging 0.99
R0560:Slfn3 UTSW 11 83213152 missense probably damaging 0.99
R0788:Slfn3 UTSW 11 83212836 missense possibly damaging 0.47
R1602:Slfn3 UTSW 11 83212715 missense probably damaging 1.00
R1713:Slfn3 UTSW 11 83213314 missense probably damaging 0.98
R1881:Slfn3 UTSW 11 83213376 missense possibly damaging 0.80
R2264:Slfn3 UTSW 11 83212972 missense probably benign 0.00
R2441:Slfn3 UTSW 11 83212683 missense probably benign 0.00
R2921:Slfn3 UTSW 11 83215045 missense probably benign 0.01
R5099:Slfn3 UTSW 11 83214938 missense probably damaging 0.98
R5448:Slfn3 UTSW 11 83214605 missense probably damaging 0.99
R6441:Slfn3 UTSW 11 83214914 missense probably benign 0.00
R6527:Slfn3 UTSW 11 83213106 missense probably benign 0.01
R6785:Slfn3 UTSW 11 83214601 missense possibly damaging 0.73
R7128:Slfn3 UTSW 11 83214895 missense probably benign 0.00
R7344:Slfn3 UTSW 11 83212822 missense probably benign 0.28
R7528:Slfn3 UTSW 11 83214905 missense probably benign 0.01
R7763:Slfn3 UTSW 11 83214788 missense possibly damaging 0.95
R8155:Slfn3 UTSW 11 83212785 missense probably damaging 1.00
R8178:Slfn3 UTSW 11 83214679 missense probably benign 0.33
R8210:Slfn3 UTSW 11 83214506 missense possibly damaging 0.48
R8347:Slfn3 UTSW 11 83213589 missense possibly damaging 0.95
Z1176:Slfn3 UTSW 11 83213409 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCAGGAAAGGACTTCATCTGG -3'
(R):5'- TTTCAAGGTGGTGATCCCCG -3'

Sequencing Primer
(F):5'- CATCATTGTTGATCAGGACACAGAC -3'
(R):5'- GGCCCTTTCTGATTCGGC -3'
Posted On2015-06-12