Incidental Mutation 'R4163:Pcdh20'
ID321629
Institutional Source Beutler Lab
Gene Symbol Pcdh20
Ensembl Gene ENSMUSG00000050505
Gene Nameprotocadherin 20
SynonymsC630015B17Rik, PCDH13
MMRRC Submission 041006-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4163 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location88464743-88471396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 88468179 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 562 (D562N)
Ref Sequence ENSEMBL: ENSMUSP00000141860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061628] [ENSMUST00000192557]
Predicted Effect probably damaging
Transcript: ENSMUST00000061628
AA Change: D562N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054774
Gene: ENSMUSG00000050505
AA Change: D562N

DomainStartEndE-ValueType
CA 108 208 9.02e-1 SMART
CA 233 319 6.63e-16 SMART
CA 343 425 9.94e-2 SMART
CA 455 534 7.48e-3 SMART
CA 558 638 5.46e-26 SMART
CA 662 741 7.2e-26 SMART
CA 768 852 9.6e-13 SMART
low complexity region 860 871 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192557
AA Change: D562N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141860
Gene: ENSMUSG00000050505
AA Change: D562N

DomainStartEndE-ValueType
CA 108 208 9.02e-1 SMART
CA 233 319 6.63e-16 SMART
CA 343 425 9.94e-2 SMART
CA 455 534 7.48e-3 SMART
CA 558 638 5.46e-26 SMART
CA 662 741 7.2e-26 SMART
CA 768 852 9.6e-13 SMART
low complexity region 860 871 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
Meta Mutation Damage Score 0.9149 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The encoded protein contains six extracellular cadherin domains, a transmembrane domain, and a cytoplasmic tail differing from those of the classical cadherins. The encoded protein may play a role in cell adhesion in the nervous system and has been shown to be specifically expressed in newly differentiated olfactory sensory neurons and their axons during development. In adult mice, the expression of this protein in the olfactory system is more restricted but shows a gender difference with higher expression in the male than in the female. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T C 17: 28,899,529 Y643C probably benign Het
4930555F03Rik G A 8: 49,495,496 noncoding transcript Het
Abca8a C T 11: 110,050,982 D1154N probably benign Het
Adgrf4 A G 17: 42,667,586 F289L probably benign Het
Alkbh2 A G 5: 114,127,552 L63S probably damaging Het
Atp13a4 A T 16: 29,541,250 N19K possibly damaging Het
Birc6 T A 17: 74,626,980 Y2544N probably damaging Het
Bpifa3 A G 2: 154,135,596 N118S probably damaging Het
Chst10 T A 1: 38,871,823 M87L probably benign Het
Cnot9 C T 1: 74,528,847 P298L probably damaging Het
Cops5 T C 1: 10,030,687 Y228C probably damaging Het
Dcaf8 T G 1: 172,192,570 L492R probably damaging Het
Dis3l2 A G 1: 86,821,237 S128G probably benign Het
Dock1 A G 7: 134,744,322 R198G possibly damaging Het
Elovl7 T A 13: 108,267,370 M82K possibly damaging Het
Fam189a2 G A 19: 23,975,629 A439V probably damaging Het
Fam189a2 C T 19: 23,975,638 S436N probably damaging Het
Fcgr2b T C 1: 170,963,447 D259G possibly damaging Het
Flnb A T 14: 7,915,374 I1502F possibly damaging Het
Frk C T 10: 34,591,872 P294L probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm128 C A 3: 95,240,491 R164L probably benign Het
Gm2223 C T X: 33,505,784 noncoding transcript Het
Hexdc C A 11: 121,221,149 A423E probably benign Het
Itgax G T 7: 128,144,700 V878F probably benign Het
Kank2 A T 9: 21,795,568 D51E probably damaging Het
Kcna4 G C 2: 107,295,806 W295S probably damaging Het
Mfsd12 A G 10: 81,361,097 probably null Het
Mis12 A G 11: 71,025,656 T172A probably benign Het
Myo10 T A 15: 25,726,415 probably null Het
Myo18a G T 11: 77,829,708 R1103L possibly damaging Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Ntrk2 T C 13: 58,860,240 V272A probably damaging Het
Olfr488 A T 7: 108,255,832 I102N probably benign Het
Olfr58 A T 9: 19,783,790 Y219F possibly damaging Het
Olfr699 A T 7: 106,790,279 C241S probably damaging Het
Prep T C 10: 45,067,340 F4L probably benign Het
Prep G T 10: 45,067,362 R11L possibly damaging Het
Ptgs1 C T 2: 36,251,334 R598C possibly damaging Het
Rasgrp1 T C 2: 117,282,654 D759G probably benign Het
Setd5 T C 6: 113,119,584 S584P probably benign Het
Shank3 A G 15: 89,549,594 D1514G probably damaging Het
Shox2 T C 3: 66,973,771 probably benign Het
Slc44a5 A T 3: 154,261,373 R565S possibly damaging Het
Slc7a5 A G 8: 121,888,400 L236S probably benign Het
Slfn3 A T 11: 83,212,770 I156F probably damaging Het
Spout1 C T 2: 30,177,577 probably benign Het
Trim72 T C 7: 128,007,908 V203A probably benign Het
Vrk2 T A 11: 26,547,915 I90L probably benign Het
Zc3h12c A T 9: 52,115,699 Y788N probably damaging Het
Zfp831 A G 2: 174,644,029 T166A possibly damaging Het
Other mutations in Pcdh20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Pcdh20 APN 14 88467881 missense possibly damaging 0.65
IGL01112:Pcdh20 APN 14 88467200 missense probably benign 0.01
IGL01586:Pcdh20 APN 14 88470908 missense probably benign 0.37
IGL02007:Pcdh20 APN 14 88469595 missense probably benign 0.09
IGL02545:Pcdh20 APN 14 88468844 missense possibly damaging 0.74
IGL02935:Pcdh20 APN 14 88467002 utr 3 prime probably benign
PIT4362001:Pcdh20 UTSW 14 88467026 missense probably damaging 0.97
PIT4403001:Pcdh20 UTSW 14 88467026 missense probably damaging 0.97
PIT4453001:Pcdh20 UTSW 14 88467308 missense probably damaging 1.00
R0322:Pcdh20 UTSW 14 88468947 missense probably benign 0.24
R0372:Pcdh20 UTSW 14 88469003 missense probably damaging 1.00
R0391:Pcdh20 UTSW 14 88468668 missense probably benign
R0575:Pcdh20 UTSW 14 88467612 missense probably damaging 1.00
R0789:Pcdh20 UTSW 14 88468790 missense probably damaging 1.00
R1370:Pcdh20 UTSW 14 88468301 missense probably benign 0.00
R1465:Pcdh20 UTSW 14 88469237 missense probably benign 0.00
R1465:Pcdh20 UTSW 14 88469237 missense probably benign 0.00
R1664:Pcdh20 UTSW 14 88468322 missense possibly damaging 0.63
R1677:Pcdh20 UTSW 14 88467974 missense probably damaging 1.00
R1764:Pcdh20 UTSW 14 88469184 missense possibly damaging 0.77
R1907:Pcdh20 UTSW 14 88468704 missense probably benign 0.01
R2043:Pcdh20 UTSW 14 88467155 missense probably benign 0.01
R2430:Pcdh20 UTSW 14 88467548 missense probably damaging 1.00
R2471:Pcdh20 UTSW 14 88467236 missense probably benign 0.00
R3838:Pcdh20 UTSW 14 88468463 missense probably benign 0.00
R4472:Pcdh20 UTSW 14 88468998 missense probably benign 0.21
R4602:Pcdh20 UTSW 14 88468430 missense probably damaging 1.00
R4681:Pcdh20 UTSW 14 88467616 missense probably damaging 1.00
R4918:Pcdh20 UTSW 14 88467668 missense probably damaging 1.00
R4921:Pcdh20 UTSW 14 88469726 missense probably benign 0.01
R5204:Pcdh20 UTSW 14 88468915 missense probably damaging 1.00
R5256:Pcdh20 UTSW 14 88468377 missense probably benign
R5652:Pcdh20 UTSW 14 88467324 missense probably damaging 1.00
R5815:Pcdh20 UTSW 14 88470876 missense probably benign 0.03
R6195:Pcdh20 UTSW 14 88468052 missense probably benign 0.39
R6233:Pcdh20 UTSW 14 88468052 missense probably benign 0.39
R6848:Pcdh20 UTSW 14 88467254 missense probably benign 0.03
R6913:Pcdh20 UTSW 14 88468602 missense probably benign
R7044:Pcdh20 UTSW 14 88469171 missense probably damaging 0.98
R7224:Pcdh20 UTSW 14 88469075 missense possibly damaging 0.85
R7388:Pcdh20 UTSW 14 88468667 missense probably benign 0.33
R7486:Pcdh20 UTSW 14 88468614 missense possibly damaging 0.79
R7651:Pcdh20 UTSW 14 88469153 missense probably damaging 1.00
R7664:Pcdh20 UTSW 14 88469367 missense probably benign
R7706:Pcdh20 UTSW 14 88467357 missense probably damaging 1.00
R7832:Pcdh20 UTSW 14 88469707 missense probably null 0.02
R7892:Pcdh20 UTSW 14 88467431 nonsense probably null
R7915:Pcdh20 UTSW 14 88469707 missense probably null 0.02
R7975:Pcdh20 UTSW 14 88467431 nonsense probably null
X0028:Pcdh20 UTSW 14 88467617 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCACTGTAGCCACTGATTC -3'
(R):5'- AAAGCCTATGGACTATGAAGTGC -3'

Sequencing Primer
(F):5'- ACTGTAGCCACTGATTCTCTGGG -3'
(R):5'- GTGCAGTCCTTCTATGAAATAGCTG -3'
Posted On2015-06-12