Incidental Mutation 'R4163:Atp13a4'
ID321632
Institutional Source Beutler Lab
Gene Symbol Atp13a4
Ensembl Gene ENSMUSG00000038094
Gene NameATPase type 13A4
Synonyms9330174J19Rik, 4631413J11Rik
MMRRC Submission 041006-MU
Accession Numbers

Genbank: NM_001164612, NM_172613, NM_001164613

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4163 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location29395853-29544864 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 29541250 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 19 (N19K)
Ref Sequence ENSEMBL: ENSMUSP00000138583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039090] [ENSMUST00000057018] [ENSMUST00000182013] [ENSMUST00000182627]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039090
AA Change: N19K

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000048753
Gene: ENSMUSG00000038094
AA Change: N19K

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 143 8.4e-31 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 229 476 1.7e-36 PFAM
Pfam:Hydrolase 481 769 3.9e-11 PFAM
Pfam:HAD 484 787 4.1e-14 PFAM
Pfam:Hydrolase_like2 574 637 1.2e-9 PFAM
transmembrane domain 824 846 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057018
AA Change: N19K

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000060987
Gene: ENSMUSG00000038094
AA Change: N19K

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 142 9.6e-34 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 228 476 1.6e-34 PFAM
Pfam:Hydrolase 481 767 1.1e-10 PFAM
Pfam:HAD 484 858 3.3e-23 PFAM
Pfam:Cation_ATPase 573 637 4.9e-8 PFAM
transmembrane domain 902 924 N/A INTRINSIC
transmembrane domain 934 951 N/A INTRINSIC
transmembrane domain 972 994 N/A INTRINSIC
low complexity region 1014 1023 N/A INTRINSIC
transmembrane domain 1040 1057 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1107 1126 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000182013
AA Change: N19K

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138583
Gene: ENSMUSG00000038094
AA Change: N19K

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 84 4.2e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000182627
AA Change: N19K

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000138479
Gene: ENSMUSG00000038094
AA Change: N19K

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 143 2.1e-29 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 229 476 3.9e-35 PFAM
Pfam:Hydrolase 481 861 4.2e-16 PFAM
Pfam:HAD 484 858 1.9e-23 PFAM
Pfam:Hydrolase_like2 574 637 2.2e-8 PFAM
transmembrane domain 902 924 N/A INTRINSIC
transmembrane domain 934 951 N/A INTRINSIC
transmembrane domain 972 994 N/A INTRINSIC
low complexity region 1014 1023 N/A INTRINSIC
transmembrane domain 1040 1057 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1107 1126 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182694
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182824
Meta Mutation Damage Score 0.1147 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T C 17: 28,899,529 Y643C probably benign Het
4930555F03Rik G A 8: 49,495,496 noncoding transcript Het
Abca8a C T 11: 110,050,982 D1154N probably benign Het
Adgrf4 A G 17: 42,667,586 F289L probably benign Het
Alkbh2 A G 5: 114,127,552 L63S probably damaging Het
Birc6 T A 17: 74,626,980 Y2544N probably damaging Het
Bpifa3 A G 2: 154,135,596 N118S probably damaging Het
Chst10 T A 1: 38,871,823 M87L probably benign Het
Cnot9 C T 1: 74,528,847 P298L probably damaging Het
Cops5 T C 1: 10,030,687 Y228C probably damaging Het
Dcaf8 T G 1: 172,192,570 L492R probably damaging Het
Dis3l2 A G 1: 86,821,237 S128G probably benign Het
Dock1 A G 7: 134,744,322 R198G possibly damaging Het
Elovl7 T A 13: 108,267,370 M82K possibly damaging Het
Fam189a2 G A 19: 23,975,629 A439V probably damaging Het
Fam189a2 C T 19: 23,975,638 S436N probably damaging Het
Fcgr2b T C 1: 170,963,447 D259G possibly damaging Het
Flnb A T 14: 7,915,374 I1502F possibly damaging Het
Frk C T 10: 34,591,872 P294L probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm128 C A 3: 95,240,491 R164L probably benign Het
Gm2223 C T X: 33,505,784 noncoding transcript Het
Hexdc C A 11: 121,221,149 A423E probably benign Het
Itgax G T 7: 128,144,700 V878F probably benign Het
Kank2 A T 9: 21,795,568 D51E probably damaging Het
Kcna4 G C 2: 107,295,806 W295S probably damaging Het
Mfsd12 A G 10: 81,361,097 probably null Het
Mis12 A G 11: 71,025,656 T172A probably benign Het
Myo10 T A 15: 25,726,415 probably null Het
Myo18a G T 11: 77,829,708 R1103L possibly damaging Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Ntrk2 T C 13: 58,860,240 V272A probably damaging Het
Olfr488 A T 7: 108,255,832 I102N probably benign Het
Olfr58 A T 9: 19,783,790 Y219F possibly damaging Het
Olfr699 A T 7: 106,790,279 C241S probably damaging Het
Pcdh20 C T 14: 88,468,179 D562N probably damaging Het
Prep T C 10: 45,067,340 F4L probably benign Het
Prep G T 10: 45,067,362 R11L possibly damaging Het
Ptgs1 C T 2: 36,251,334 R598C possibly damaging Het
Rasgrp1 T C 2: 117,282,654 D759G probably benign Het
Setd5 T C 6: 113,119,584 S584P probably benign Het
Shank3 A G 15: 89,549,594 D1514G probably damaging Het
Shox2 T C 3: 66,973,771 probably benign Het
Slc44a5 A T 3: 154,261,373 R565S possibly damaging Het
Slc7a5 A G 8: 121,888,400 L236S probably benign Het
Slfn3 A T 11: 83,212,770 I156F probably damaging Het
Spout1 C T 2: 30,177,577 probably benign Het
Trim72 T C 7: 128,007,908 V203A probably benign Het
Vrk2 T A 11: 26,547,915 I90L probably benign Het
Zc3h12c A T 9: 52,115,699 Y788N probably damaging Het
Zfp831 A G 2: 174,644,029 T166A possibly damaging Het
Other mutations in Atp13a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00563:Atp13a4 APN 16 29403778 splice site probably benign
IGL01577:Atp13a4 APN 16 29441284 missense possibly damaging 0.77
IGL01834:Atp13a4 APN 16 29415777 splice site probably benign
IGL02165:Atp13a4 APN 16 29434010 missense probably damaging 1.00
IGL02194:Atp13a4 APN 16 29456629 missense probably damaging 1.00
IGL02322:Atp13a4 APN 16 29440102 missense probably benign 0.00
IGL02553:Atp13a4 APN 16 29422703 missense probably benign 0.03
IGL02821:Atp13a4 APN 16 29441307 missense probably benign 0.01
IGL03349:Atp13a4 APN 16 29456671 missense probably benign 0.01
G5030:Atp13a4 UTSW 16 29455488 missense probably damaging 1.00
R0091:Atp13a4 UTSW 16 29455395 missense probably damaging 1.00
R0100:Atp13a4 UTSW 16 29421724 missense probably damaging 1.00
R0278:Atp13a4 UTSW 16 29454834 missense probably damaging 1.00
R1263:Atp13a4 UTSW 16 29471953 missense possibly damaging 0.60
R1378:Atp13a4 UTSW 16 29420428 missense probably damaging 1.00
R1575:Atp13a4 UTSW 16 29409710 missense probably benign 0.01
R1720:Atp13a4 UTSW 16 29408928 missense probably damaging 0.99
R1759:Atp13a4 UTSW 16 29456611 missense probably damaging 0.99
R1967:Atp13a4 UTSW 16 29479854 missense probably damaging 0.99
R2030:Atp13a4 UTSW 16 29422684 missense probably damaging 1.00
R2113:Atp13a4 UTSW 16 29441284 missense possibly damaging 0.77
R3409:Atp13a4 UTSW 16 29413749 missense probably damaging 1.00
R3410:Atp13a4 UTSW 16 29413749 missense probably damaging 1.00
R4032:Atp13a4 UTSW 16 29418571 missense probably damaging 1.00
R4652:Atp13a4 UTSW 16 29452603 missense probably damaging 1.00
R4772:Atp13a4 UTSW 16 29420835 intron probably benign
R4795:Atp13a4 UTSW 16 29490008 critical splice donor site probably null
R4898:Atp13a4 UTSW 16 29408961 nonsense probably null
R4996:Atp13a4 UTSW 16 29472004 missense probably damaging 1.00
R5112:Atp13a4 UTSW 16 29409868 missense possibly damaging 0.87
R5259:Atp13a4 UTSW 16 29456610 missense probably damaging 1.00
R5395:Atp13a4 UTSW 16 29420888 nonsense probably null
R5395:Atp13a4 UTSW 16 29456604 missense possibly damaging 0.94
R5640:Atp13a4 UTSW 16 29415831 missense probably damaging 0.98
R5809:Atp13a4 UTSW 16 29433987 missense possibly damaging 0.56
R5856:Atp13a4 UTSW 16 29433987 missense possibly damaging 0.94
R5912:Atp13a4 UTSW 16 29456571 missense probably benign 0.33
R6282:Atp13a4 UTSW 16 29434004 missense probably benign 0.00
R6404:Atp13a4 UTSW 16 29471901 nonsense probably null
R6497:Atp13a4 UTSW 16 29479901 missense probably damaging 1.00
R6577:Atp13a4 UTSW 16 29479841 missense probably benign 0.03
R6806:Atp13a4 UTSW 16 29469280 missense probably damaging 1.00
R7229:Atp13a4 UTSW 16 29420905 missense probably benign 0.05
R7438:Atp13a4 UTSW 16 29441196 missense
R7493:Atp13a4 UTSW 16 29471956 missense
R7712:Atp13a4 UTSW 16 29459487 missense
R7739:Atp13a4 UTSW 16 29456601 missense
R7897:Atp13a4 UTSW 16 29396466 missense
R7950:Atp13a4 UTSW 16 29449917 missense
R8217:Atp13a4 UTSW 16 29403801 missense
R8227:Atp13a4 UTSW 16 29403845 missense
R8273:Atp13a4 UTSW 16 29471902 missense
R8508:Atp13a4 UTSW 16 29454769 nonsense probably null
Z1176:Atp13a4 UTSW 16 29422587 missense probably null
Predicted Primers PCR Primer
(F):5'- CATGCTGTCAGGAGTTACATTC -3'
(R):5'- CCAGAAATTCCTCCTGGCAC -3'

Sequencing Primer
(F):5'- TGTCAGGAGTTACATTCACGGGAC -3'
(R):5'- GGAGGAGTCCACTTCGCTAAATATTG -3'
Posted On2015-06-12