Incidental Mutation 'R4164:Smarcal1'
ID321640
Institutional Source Beutler Lab
Gene Symbol Smarcal1
Ensembl Gene ENSMUSG00000039354
Gene NameSWI/SNF related matrix associated, actin dependent regulator of chromatin, subfamily a-like 1
Synonyms6030401P21Rik, Mharp
MMRRC Submission 041638-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4164 (G1)
Quality Score164
Status Validated
Chromosome1
Chromosomal Location72583251-72633134 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 72626689 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047615] [ENSMUST00000152225]
Predicted Effect probably benign
Transcript: ENSMUST00000047615
SMART Domains Protein: ENSMUSP00000047589
Gene: ENSMUSG00000039354

DomainStartEndE-ValueType
low complexity region 31 51 N/A INTRINSIC
Pfam:HARP 214 268 3.6e-26 PFAM
Pfam:HARP 302 356 1.2e-26 PFAM
DEXDc 391 564 7.01e-17 SMART
low complexity region 632 641 N/A INTRINSIC
HELICc 697 780 8.17e-18 SMART
low complexity region 879 889 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126832
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150725
Predicted Effect probably benign
Transcript: ENSMUST00000152225
SMART Domains Protein: ENSMUSP00000137833
Gene: ENSMUSG00000039354

DomainStartEndE-ValueType
low complexity region 31 51 N/A INTRINSIC
Pfam:HARP 214 268 8e-29 PFAM
Pfam:HARP 302 356 3e-26 PFAM
DEXDc 391 564 7.01e-17 SMART
low complexity region 632 641 N/A INTRINSIC
HELICc 697 780 8.17e-18 SMART
low complexity region 879 889 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 89% (40/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein shows sequence similarity to the E. coli RNA polymerase-binding protein HepA. Mutations in this gene are a cause of Schimke immunoosseous dysplasia (SIOD), an autosomal recessive disorder with the diagnostic features of spondyloepiphyseal dysplasia, renal dysfunction, and T-cell immunodeficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display reduced B cell counts and increased susceptibility to heat induced mortality. Treatment of homozygous null mice with alpha-amanitin results in phenotypes similar to Schimke Type Immunoosseous Dysplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 C T 11: 69,890,037 A164T probably benign Het
Ash1l A G 3: 88,981,966 D384G probably damaging Het
Cntn5 A G 9: 9,781,676 V666A probably damaging Het
Defb41 C T 1: 18,260,597 C42Y probably damaging Het
Dennd4c C A 4: 86,807,527 N739K probably benign Het
Dnah6 C T 6: 73,089,592 W2598* probably null Het
Ell G T 8: 70,581,573 R30L probably damaging Het
Fam189a2 G A 19: 23,975,629 A439V probably damaging Het
Fam189a2 C T 19: 23,975,638 S436N probably damaging Het
Fer1l6 A C 15: 58,559,238 R247S possibly damaging Het
Flnb A T 14: 7,915,374 I1502F possibly damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm2223 C T X: 33,505,784 noncoding transcript Het
Ifi203 A T 1: 173,928,463 probably benign Het
Ighm T A 12: 113,422,295 E108V unknown Het
Il23r T A 6: 67,423,663 Q561L probably benign Het
Kank1 A G 19: 25,411,072 D703G probably benign Het
Kcnt2 A T 1: 140,609,630 Y1109F probably damaging Het
Lamb2 T A 9: 108,490,298 Y1760N probably damaging Het
Lrpprc T C 17: 84,731,189 E950G possibly damaging Het
Lrrc66 T A 5: 73,629,776 probably null Het
Mtbp T C 15: 55,609,521 V627A probably benign Het
Myo10 T A 15: 25,726,415 probably null Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nipbl T C 15: 8,338,934 N1142S probably benign Het
Nrxn2 G A 19: 6,532,143 V660I probably damaging Het
Oas1c T C 5: 120,808,139 E98G probably damaging Het
Olfr160 T G 9: 37,711,698 I194L probably benign Het
Otx1 A G 11: 21,996,638 probably benign Het
Prkcd A G 14: 30,601,197 F461L probably damaging Het
Prune2 T C 19: 17,003,734 F85S possibly damaging Het
Rnf214 G A 9: 45,871,912 R184W probably damaging Het
Scn5a T C 9: 119,495,778 N1328S probably damaging Het
Secisbp2l T C 2: 125,751,883 probably benign Het
Snx21 T C 2: 164,786,850 Y138H probably damaging Het
Sox5 T A 6: 144,116,480 R149W probably damaging Het
Spout1 C T 2: 30,177,577 probably benign Het
Tlr1 A G 5: 64,927,202 C11R possibly damaging Het
Vmn2r23 A T 6: 123,729,738 H509L probably benign Het
Other mutations in Smarcal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Smarcal1 APN 1 72616565 missense possibly damaging 0.80
IGL01658:Smarcal1 APN 1 72586131 missense probably benign 0.00
IGL01980:Smarcal1 APN 1 72616520 nonsense probably null
IGL02007:Smarcal1 APN 1 72595940 missense probably damaging 0.98
IGL02153:Smarcal1 APN 1 72633055 utr 3 prime probably benign
IGL02496:Smarcal1 APN 1 72620088 missense probably damaging 1.00
IGL03084:Smarcal1 APN 1 72598935 splice site probably null
IGL03135:Smarcal1 APN 1 72616501 splice site probably null
IGL03306:Smarcal1 APN 1 72626466 missense probably benign 0.12
R0133:Smarcal1 UTSW 1 72632851 missense probably benign 0.05
R0315:Smarcal1 UTSW 1 72595811 nonsense probably null
R0396:Smarcal1 UTSW 1 72626473 missense probably benign 0.03
R0891:Smarcal1 UTSW 1 72598856 missense probably damaging 0.99
R1799:Smarcal1 UTSW 1 72585961 missense probably damaging 0.97
R1854:Smarcal1 UTSW 1 72586099 missense possibly damaging 0.77
R3725:Smarcal1 UTSW 1 72626596 missense possibly damaging 0.88
R3726:Smarcal1 UTSW 1 72626596 missense possibly damaging 0.88
R4438:Smarcal1 UTSW 1 72611478 intron probably benign
R4722:Smarcal1 UTSW 1 72611337 missense probably damaging 1.00
R4796:Smarcal1 UTSW 1 72597440 missense probably benign
R4989:Smarcal1 UTSW 1 72632860 missense possibly damaging 0.84
R5242:Smarcal1 UTSW 1 72591083 missense probably benign 0.00
R5367:Smarcal1 UTSW 1 72595976 critical splice donor site probably null
R5418:Smarcal1 UTSW 1 72598909 missense probably benign 0.01
R5430:Smarcal1 UTSW 1 72626617 missense probably damaging 1.00
R5591:Smarcal1 UTSW 1 72591253 missense probably damaging 1.00
R5607:Smarcal1 UTSW 1 72586213 missense probably benign 0.00
R5809:Smarcal1 UTSW 1 72591137 missense probably benign 0.09
R6395:Smarcal1 UTSW 1 72616557 missense possibly damaging 0.82
R6447:Smarcal1 UTSW 1 72585874 missense probably damaging 0.96
R6852:Smarcal1 UTSW 1 72591173 missense possibly damaging 0.75
R7060:Smarcal1 UTSW 1 72612942 missense probably damaging 1.00
R7692:Smarcal1 UTSW 1 72586020 missense probably benign 0.08
R7975:Smarcal1 UTSW 1 72612991 missense probably benign 0.08
R8232:Smarcal1 UTSW 1 72626563 missense probably damaging 1.00
Z1177:Smarcal1 UTSW 1 72591267 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACACATCCGGATCGATGG -3'
(R):5'- CACTTGCAGAACATGTCATCTTC -3'

Sequencing Primer
(F):5'- ATCCGGATCGATGGCTCCAC -3'
(R):5'- TGCCTGCATGCATGTGC -3'
Posted On2015-06-12