Mutagenetix > Incidental Mutations

Incidental Mutation 'R4164:Secisbp2l'

321645

Institutional Source

Beutler Lab

Gene Symbol

Secisbp2l

Ensembl Gene

ENSMUSG00000035093

Gene Name

SECIS binding protein 2-like

Synonyms

3110001I20Rik

MMRRC Submission

041638-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.785) question?

Stock #

R4164 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

125736986-125782870 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

T to C at 125751883 bp

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053699]

Predicted Effect

probably benign
Transcript: ENSMUST00000053699

SMART Domains

Protein: ENSMUSP00000055772
Gene: ENSMUSG00000035093

Domain	Start	End	E-Value	Type
low complexity region	441	459	N/A	INTRINSIC
low complexity region	555	568	N/A	INTRINSIC
Pfam:Ribosomal_L7Ae	700	802	7.6e-24	PFAM
low complexity region	821	831	N/A	INTRINSIC
low complexity region	970	978	N/A	INTRINSIC
low complexity region	985	996	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136450

Predicted Effect

probably benign
Transcript: ENSMUST00000139944

SMART Domains

Protein: ENSMUSP00000121529
Gene: ENSMUSG00000035093

Domain	Start	End	E-Value	Type
low complexity region	67	85	N/A	INTRINSIC
low complexity region	181	194	N/A	INTRINSIC
Pfam:Ribosomal_L7Ae	326	427	3.5e-24	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

89% (40/45)

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acap1	C	T	11: 69,890,037	A164T	probably benign	Het
Ash1l	A	G	3: 88,981,966	D384G	probably damaging	Het
Cntn5	A	G	9: 9,781,676	V666A	probably damaging	Het
Defb41	C	T	1: 18,260,597	C42Y	probably damaging	Het
Dennd4c	C	A	4: 86,807,527	N739K	probably benign	Het
Dnah6	C	T	6: 73,089,592	W2598*	probably null	Het
Ell	G	T	8: 70,581,573	R30L	probably damaging	Het
Fam189a2	G	A	19: 23,975,629	A439V	probably damaging	Het
Fam189a2	C	T	19: 23,975,638	S436N	probably damaging	Het
Fer1l6	A	C	15: 58,559,238	R247S	possibly damaging	Het
Flnb	A	T	14: 7,915,374	I1502F	possibly damaging	Het
Gkn3	C	T	6: 87,383,525	A163T	probably damaging	Het
Gm2223	C	T	X: 33,505,784		noncoding transcript	Het
Ifi203	A	T	1: 173,928,463		probably benign	Het
Ighm	T	A	12: 113,422,295	E108V	unknown	Het
Il23r	T	A	6: 67,423,663	Q561L	probably benign	Het
Kank1	A	G	19: 25,411,072	D703G	probably benign	Het
Kcnt2	A	T	1: 140,609,630	Y1109F	probably damaging	Het
Lamb2	T	A	9: 108,490,298	Y1760N	probably damaging	Het
Lrpprc	T	C	17: 84,731,189	E950G	possibly damaging	Het
Lrrc66	T	A	5: 73,629,776		probably null	Het
Mtbp	T	C	15: 55,609,521	V627A	probably benign	Het
Myo10	T	A	15: 25,726,415		probably null	Het
Nfix	CAAAAA	CAAAA	8: 84,716,247		probably null	Het
Nipbl	T	C	15: 8,338,934	N1142S	probably benign	Het
Nrxn2	G	A	19: 6,532,143	V660I	probably damaging	Het
Oas1c	T	C	5: 120,808,139	E98G	probably damaging	Het
Olfr160	T	G	9: 37,711,698	I194L	probably benign	Het
Otx1	A	G	11: 21,996,638		probably benign	Het
Prkcd	A	G	14: 30,601,197	F461L	probably damaging	Het
Prune2	T	C	19: 17,003,734	F85S	possibly damaging	Het
Rnf214	G	A	9: 45,871,912	R184W	probably damaging	Het
Scn5a	T	C	9: 119,495,778	N1328S	probably damaging	Het
Smarcal1	A	G	1: 72,626,689		probably benign	Het
Snx21	T	C	2: 164,786,850	Y138H	probably damaging	Het
Sox5	T	A	6: 144,116,480	R149W	probably damaging	Het
Spout1	C	T	2: 30,177,577		probably benign	Het
Tlr1	A	G	5: 64,927,202	C11R	possibly damaging	Het
Vmn2r23	A	T	6: 123,729,738	H509L	probably benign	Het

Other mutations in Secisbp2l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Secisbp2l	APN	2	125743856	missense	probably damaging	0.99
IGL00644:Secisbp2l	APN	2	125743844	missense	probably damaging	1.00
IGL01093:Secisbp2l	APN	2	125740325	missense	probably benign
IGL01621:Secisbp2l	APN	2	125773211	missense	probably benign
IGL01955:Secisbp2l	APN	2	125743812	critical splice donor site	probably null
IGL02036:Secisbp2l	APN	2	125758207	missense	probably benign
IGL02045:Secisbp2l	APN	2	125775578	missense	possibly damaging	0.82
IGL02182:Secisbp2l	APN	2	125747577	missense	probably damaging	1.00
IGL02408:Secisbp2l	APN	2	125740869	nonsense	probably null
IGL02455:Secisbp2l	APN	2	125773478	missense	possibly damaging	0.89
IGL02953:Secisbp2l	APN	2	125760274	missense	probably benign	0.36
Rift	UTSW	2	125768193	missense	probably damaging	1.00
Seismic	UTSW	2	125745909	missense	probably damaging	1.00
R0097:Secisbp2l	UTSW	2	125771456	missense	probably damaging	0.96
R0097:Secisbp2l	UTSW	2	125771456	missense	probably damaging	0.96
R1415:Secisbp2l	UTSW	2	125740365	missense	probably benign	0.00
R1626:Secisbp2l	UTSW	2	125775686	missense	probably damaging	0.99
R1926:Secisbp2l	UTSW	2	125740677	missense	probably damaging	0.99
R1940:Secisbp2l	UTSW	2	125740339	missense	probably damaging	1.00
R1970:Secisbp2l	UTSW	2	125747510	missense	probably damaging	1.00
R2100:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R2240:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R2252:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R2253:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R2472:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R2474:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R2475:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R2990:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R2993:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R3113:Secisbp2l	UTSW	2	125750286	missense	probably damaging	1.00
R3696:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R3749:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R3750:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R3800:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R3810:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R3812:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R3815:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R3816:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R3817:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R3880:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4077:Secisbp2l	UTSW	2	125751865	splice site	probably benign
R4096:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4097:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4332:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4418:Secisbp2l	UTSW	2	125752915	missense	probably benign	0.00
R4598:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4600:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4602:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4603:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4678:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4679:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4684:Secisbp2l	UTSW	2	125745942	missense	probably damaging	1.00
R4741:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4749:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R4934:Secisbp2l	UTSW	2	125740489	missense	probably damaging	0.99
R5245:Secisbp2l	UTSW	2	125747591	missense	probably damaging	1.00
R5521:Secisbp2l	UTSW	2	125752977	missense	possibly damaging	0.94
R5547:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R5630:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R5631:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R5632:Secisbp2l	UTSW	2	125740737	missense	possibly damaging	0.66
R6039:Secisbp2l	UTSW	2	125773216	missense	probably benign	0.28
R6039:Secisbp2l	UTSW	2	125773216	missense	probably benign	0.28
R6378:Secisbp2l	UTSW	2	125768325	missense	possibly damaging	0.78
R6616:Secisbp2l	UTSW	2	125768226	missense	probably damaging	0.96
R6938:Secisbp2l	UTSW	2	125750352	missense	probably damaging	1.00
R7287:Secisbp2l	UTSW	2	125740369	missense	probably benign
R7373:Secisbp2l	UTSW	2	125757271	missense	probably damaging	0.99
R7403:Secisbp2l	UTSW	2	125760279	missense	possibly damaging	0.73
R7484:Secisbp2l	UTSW	2	125771532	nonsense	probably null
R7504:Secisbp2l	UTSW	2	125758171	missense	probably benign	0.30
R7762:Secisbp2l	UTSW	2	125768193	missense	probably damaging	1.00
R7769:Secisbp2l	UTSW	2	125771545	critical splice acceptor site	probably benign
R8018:Secisbp2l	UTSW	2	125745909	missense	probably damaging	1.00
R8487:Secisbp2l	UTSW	2	125775582	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGTGCAACTGCTACTGGAGG -3'
(R):5'- AGACGTGCCGTATTTGCTTG -3'

Sequencing Primer
(F):5'- AACTGCTACTGGAGGCGCAG -3'
(R):5'- AGTTTGATTGTGACTCTTAGCACTC -3'

Posted On

2015-06-12