Incidental Mutation 'R4164:Snx21'
ID321646
Institutional Source Beutler Lab
Gene Symbol Snx21
Ensembl Gene ENSMUSG00000050373
Gene Namesorting nexin family member 21
Synonyms
MMRRC Submission 041638-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4164 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location164785823-164793816 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 164786850 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 138 (Y138H)
Ref Sequence ENSEMBL: ENSMUSP00000054137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056181] [ENSMUST00000152471] [ENSMUST00000172577] [ENSMUST00000172577] [ENSMUST00000174070]
Predicted Effect probably damaging
Transcript: ENSMUST00000056181
AA Change: Y138H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054137
Gene: ENSMUSG00000050373
AA Change: Y138H

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 17 28 N/A INTRINSIC
low complexity region 58 69 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
PX 124 232 4.19e-10 SMART
low complexity region 249 263 N/A INTRINSIC
low complexity region 334 343 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000140519
AA Change: Y19H
Predicted Effect probably damaging
Transcript: ENSMUST00000152471
AA Change: Y138H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133914
Gene: ENSMUSG00000050373
AA Change: Y138H

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 17 28 N/A INTRINSIC
low complexity region 58 69 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172577
SMART Domains Protein: ENSMUSP00000134133
Gene: ENSMUSG00000050373

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 17 28 N/A INTRINSIC
low complexity region 58 69 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172577
SMART Domains Protein: ENSMUSP00000134133
Gene: ENSMUSG00000050373

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 17 28 N/A INTRINSIC
low complexity region 58 69 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173945
Predicted Effect probably damaging
Transcript: ENSMUST00000174070
AA Change: Y138H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000133344
Gene: ENSMUSG00000050373
AA Change: Y138H

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 17 28 N/A INTRINSIC
low complexity region 58 69 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174342
Meta Mutation Damage Score 0.8842 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 89% (40/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein does not contain a coiled coil region, like some family members. The specific function of this protein has not been determined. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 C T 11: 69,890,037 A164T probably benign Het
Ash1l A G 3: 88,981,966 D384G probably damaging Het
Cntn5 A G 9: 9,781,676 V666A probably damaging Het
Defb41 C T 1: 18,260,597 C42Y probably damaging Het
Dennd4c C A 4: 86,807,527 N739K probably benign Het
Dnah6 C T 6: 73,089,592 W2598* probably null Het
Ell G T 8: 70,581,573 R30L probably damaging Het
Fam189a2 G A 19: 23,975,629 A439V probably damaging Het
Fam189a2 C T 19: 23,975,638 S436N probably damaging Het
Fer1l6 A C 15: 58,559,238 R247S possibly damaging Het
Flnb A T 14: 7,915,374 I1502F possibly damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm2223 C T X: 33,505,784 noncoding transcript Het
Ifi203 A T 1: 173,928,463 probably benign Het
Ighm T A 12: 113,422,295 E108V unknown Het
Il23r T A 6: 67,423,663 Q561L probably benign Het
Kank1 A G 19: 25,411,072 D703G probably benign Het
Kcnt2 A T 1: 140,609,630 Y1109F probably damaging Het
Lamb2 T A 9: 108,490,298 Y1760N probably damaging Het
Lrpprc T C 17: 84,731,189 E950G possibly damaging Het
Lrrc66 T A 5: 73,629,776 probably null Het
Mtbp T C 15: 55,609,521 V627A probably benign Het
Myo10 T A 15: 25,726,415 probably null Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nipbl T C 15: 8,338,934 N1142S probably benign Het
Nrxn2 G A 19: 6,532,143 V660I probably damaging Het
Oas1c T C 5: 120,808,139 E98G probably damaging Het
Olfr160 T G 9: 37,711,698 I194L probably benign Het
Otx1 A G 11: 21,996,638 probably benign Het
Prkcd A G 14: 30,601,197 F461L probably damaging Het
Prune2 T C 19: 17,003,734 F85S possibly damaging Het
Rnf214 G A 9: 45,871,912 R184W probably damaging Het
Scn5a T C 9: 119,495,778 N1328S probably damaging Het
Secisbp2l T C 2: 125,751,883 probably benign Het
Smarcal1 A G 1: 72,626,689 probably benign Het
Sox5 T A 6: 144,116,480 R149W probably damaging Het
Spout1 C T 2: 30,177,577 probably benign Het
Tlr1 A G 5: 64,927,202 C11R possibly damaging Het
Vmn2r23 A T 6: 123,729,738 H509L probably benign Het
Other mutations in Snx21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Snx21 APN 2 164786220 missense probably damaging 1.00
IGL02329:Snx21 APN 2 164792390 utr 3 prime probably benign
R4162:Snx21 UTSW 2 164786850 missense probably damaging 1.00
R5092:Snx21 UTSW 2 164786746 missense probably damaging 0.99
R5262:Snx21 UTSW 2 164791821 missense probably damaging 0.99
R6875:Snx21 UTSW 2 164791902 missense probably damaging 1.00
R7231:Snx21 UTSW 2 164786201 missense probably benign 0.00
R7757:Snx21 UTSW 2 164786165 missense probably damaging 1.00
R8001:Snx21 UTSW 2 164786737 missense probably benign 0.03
R8341:Snx21 UTSW 2 164791885 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGTTAACTCTGGAGCTAGCC -3'
(R):5'- GTCATTTGCCTGAGGACGTG -3'

Sequencing Primer
(F):5'- ACCCCCATAATGACGGGTC -3'
(R):5'- AGGACGTGTTCAGTTGACACC -3'
Posted On2015-06-12