Incidental Mutation 'R4164:Lrrc66'
ID321651
Institutional Source Beutler Lab
Gene Symbol Lrrc66
Ensembl Gene ENSMUSG00000067206
Gene Nameleucine rich repeat containing 66
SynonymsMGC:38937
MMRRC Submission 041638-MU
Accession Numbers

Genbank: NM_153568; MGI: 2387634

Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R4164 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location73606642-73632526 bp(-) (GRCm38)
Type of Mutationsplice site (2973 bp from exon)
DNA Base Change (assembly) T to A at 73629776 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000079937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081170] [ENSMUST00000087177] [ENSMUST00000152215]
Predicted Effect probably null
Transcript: ENSMUST00000081170
SMART Domains Protein: ENSMUSP00000079937
Gene: ENSMUSG00000029156

DomainStartEndE-ValueType
Pfam:Sarcoglycan_1 56 305 4.3e-67 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000087177
AA Change: E77V

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000084423
Gene: ENSMUSG00000067206
AA Change: E77V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LRR 140 162 1.81e1 SMART
LRR_TYP 163 186 9.44e-2 SMART
LRR 187 210 1.26e2 SMART
LRR 211 234 4.84e1 SMART
low complexity region 298 309 N/A INTRINSIC
transmembrane domain 369 391 N/A INTRINSIC
low complexity region 434 445 N/A INTRINSIC
low complexity region 842 859 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000152215
AA Change: E77V

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120280
Gene: ENSMUSG00000067206
AA Change: E77V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Meta Mutation Damage Score 0.1508 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 89% (40/45)
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 C T 11: 69,890,037 A164T probably benign Het
Ash1l A G 3: 88,981,966 D384G probably damaging Het
Cntn5 A G 9: 9,781,676 V666A probably damaging Het
Defb41 C T 1: 18,260,597 C42Y probably damaging Het
Dennd4c C A 4: 86,807,527 N739K probably benign Het
Dnah6 C T 6: 73,089,592 W2598* probably null Het
Ell G T 8: 70,581,573 R30L probably damaging Het
Fam189a2 G A 19: 23,975,629 A439V probably damaging Het
Fam189a2 C T 19: 23,975,638 S436N probably damaging Het
Fer1l6 A C 15: 58,559,238 R247S possibly damaging Het
Flnb A T 14: 7,915,374 I1502F possibly damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm2223 C T X: 33,505,784 noncoding transcript Het
Ifi203 A T 1: 173,928,463 probably benign Het
Ighm T A 12: 113,422,295 E108V unknown Het
Il23r T A 6: 67,423,663 Q561L probably benign Het
Kank1 A G 19: 25,411,072 D703G probably benign Het
Kcnt2 A T 1: 140,609,630 Y1109F probably damaging Het
Lamb2 T A 9: 108,490,298 Y1760N probably damaging Het
Lrpprc T C 17: 84,731,189 E950G possibly damaging Het
Mtbp T C 15: 55,609,521 V627A probably benign Het
Myo10 T A 15: 25,726,415 probably null Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nipbl T C 15: 8,338,934 N1142S probably benign Het
Nrxn2 G A 19: 6,532,143 V660I probably damaging Het
Oas1c T C 5: 120,808,139 E98G probably damaging Het
Olfr160 T G 9: 37,711,698 I194L probably benign Het
Otx1 A G 11: 21,996,638 probably benign Het
Prkcd A G 14: 30,601,197 F461L probably damaging Het
Prune2 T C 19: 17,003,734 F85S possibly damaging Het
Rnf214 G A 9: 45,871,912 R184W probably damaging Het
Scn5a T C 9: 119,495,778 N1328S probably damaging Het
Secisbp2l T C 2: 125,751,883 probably benign Het
Smarcal1 A G 1: 72,626,689 probably benign Het
Snx21 T C 2: 164,786,850 Y138H probably damaging Het
Sox5 T A 6: 144,116,480 R149W probably damaging Het
Spout1 C T 2: 30,177,577 probably benign Het
Tlr1 A G 5: 64,927,202 C11R possibly damaging Het
Vmn2r23 A T 6: 123,729,738 H509L probably benign Het
Other mutations in Lrrc66
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Lrrc66 APN 5 73607114 missense probably benign 0.10
IGL00913:Lrrc66 APN 5 73608156 missense possibly damaging 0.76
IGL00954:Lrrc66 APN 5 73608398 missense possibly damaging 0.94
IGL01061:Lrrc66 APN 5 73615499 missense probably benign 0.01
IGL01343:Lrrc66 APN 5 73608463 missense probably damaging 0.98
IGL01714:Lrrc66 APN 5 73629977 missense probably benign 0.10
IGL01822:Lrrc66 APN 5 73629968 missense probably benign 0.17
IGL02005:Lrrc66 APN 5 73608734 missense possibly damaging 0.83
IGL02166:Lrrc66 APN 5 73607291 missense probably damaging 0.99
IGL02380:Lrrc66 APN 5 73629666 missense possibly damaging 0.55
IGL03162:Lrrc66 APN 5 73607382 missense probably benign
BB002:Lrrc66 UTSW 5 73608492 missense possibly damaging 0.81
BB012:Lrrc66 UTSW 5 73608492 missense possibly damaging 0.81
D4043:Lrrc66 UTSW 5 73607526 missense probably benign 0.03
R0126:Lrrc66 UTSW 5 73607088 missense probably benign 0.10
R0437:Lrrc66 UTSW 5 73607687 missense probably benign 0.23
R0638:Lrrc66 UTSW 5 73615473 splice site probably benign
R0658:Lrrc66 UTSW 5 73610944 missense probably benign 0.40
R0729:Lrrc66 UTSW 5 73608414 missense probably benign
R1603:Lrrc66 UTSW 5 73607426 missense possibly damaging 0.61
R1774:Lrrc66 UTSW 5 73610855 missense probably benign 0.16
R1831:Lrrc66 UTSW 5 73607426 missense possibly damaging 0.61
R1832:Lrrc66 UTSW 5 73607426 missense possibly damaging 0.61
R1902:Lrrc66 UTSW 5 73607622 missense probably damaging 0.99
R2858:Lrrc66 UTSW 5 73607303 missense probably benign 0.08
R4097:Lrrc66 UTSW 5 73607704 missense possibly damaging 0.94
R4582:Lrrc66 UTSW 5 73608237 missense possibly damaging 0.94
R4708:Lrrc66 UTSW 5 73629662 missense probably benign 0.06
R4856:Lrrc66 UTSW 5 73608567 missense probably benign 0.10
R4886:Lrrc66 UTSW 5 73608567 missense probably benign 0.10
R5074:Lrrc66 UTSW 5 73608011 missense probably damaging 1.00
R5464:Lrrc66 UTSW 5 73608279 missense probably benign 0.05
R5640:Lrrc66 UTSW 5 73608634 missense probably benign 0.00
R5709:Lrrc66 UTSW 5 73608863 missense probably benign
R5811:Lrrc66 UTSW 5 73615517 missense possibly damaging 0.82
R6146:Lrrc66 UTSW 5 73608089 missense probably benign 0.10
R7037:Lrrc66 UTSW 5 73607161 missense probably benign 0.10
R7041:Lrrc66 UTSW 5 73608556 missense possibly damaging 0.81
R7141:Lrrc66 UTSW 5 73629977 missense probably benign 0.10
R7201:Lrrc66 UTSW 5 73629897 missense probably benign 0.11
R7250:Lrrc66 UTSW 5 73610881 missense probably benign 0.03
R7367:Lrrc66 UTSW 5 73608381 missense probably benign 0.13
R7773:Lrrc66 UTSW 5 73607321 missense probably damaging 0.98
R7925:Lrrc66 UTSW 5 73608492 missense possibly damaging 0.81
R8057:Lrrc66 UTSW 5 73607532 nonsense probably null
R8167:Lrrc66 UTSW 5 73629609 nonsense probably null
R8552:Lrrc66 UTSW 5 73610885 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TTTGAAGGATCAGCACCTGG -3'
(R):5'- TTTGTGGAAACAGTGACAACC -3'

Sequencing Primer
(F):5'- ATCAGCACCTGGAGCCTG -3'
(R):5'- GTGGAAACAGTGACAACCCCATC -3'
Posted On2015-06-12