Incidental Mutation 'R4164:Il23r'
ID321653
Institutional Source Beutler Lab
Gene Symbol Il23r
Ensembl Gene ENSMUSG00000049093
Gene Nameinterleukin 23 receptor
Synonyms
MMRRC Submission 041638-MU
Accession Numbers

Ncbi RefSeq: NM_144548.1; MGI:2181693

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4164 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location67422932-67491855 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 67423663 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 561 (Q561L)
Ref Sequence ENSEMBL: ENSMUSP00000113342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118364]
Predicted Effect probably benign
Transcript: ENSMUST00000118364
AA Change: Q561L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000113342
Gene: ENSMUSG00000049093
AA Change: Q561L

DomainStartEndE-ValueType
FN3 140 220 1e-1 SMART
Blast:FN3 235 317 2e-38 BLAST
transmembrane domain 388 410 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 89% (40/45)
MGI Phenotype Strain: 4355925
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the receptor for IL23A/IL23. This protein pairs with the receptor molecule IL12RB1/IL12Rbeta1, and both are required for IL23A signaling. This protein associates constitutively with Janus kinase 2 (JAK2), and also binds to transcription activator STAT3 in a ligand-dependent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Th17 T cells from homozygous null mice have less secretion of IL-9 upon secondary stimulation. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(6)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 C T 11: 69,890,037 A164T probably benign Het
Ash1l A G 3: 88,981,966 D384G probably damaging Het
Cntn5 A G 9: 9,781,676 V666A probably damaging Het
Defb41 C T 1: 18,260,597 C42Y probably damaging Het
Dennd4c C A 4: 86,807,527 N739K probably benign Het
Dnah6 C T 6: 73,089,592 W2598* probably null Het
Ell G T 8: 70,581,573 R30L probably damaging Het
Fam189a2 G A 19: 23,975,629 A439V probably damaging Het
Fam189a2 C T 19: 23,975,638 S436N probably damaging Het
Fer1l6 A C 15: 58,559,238 R247S possibly damaging Het
Flnb A T 14: 7,915,374 I1502F possibly damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm2223 C T X: 33,505,784 noncoding transcript Het
Ifi203 A T 1: 173,928,463 probably benign Het
Ighm T A 12: 113,422,295 E108V unknown Het
Kank1 A G 19: 25,411,072 D703G probably benign Het
Kcnt2 A T 1: 140,609,630 Y1109F probably damaging Het
Lamb2 T A 9: 108,490,298 Y1760N probably damaging Het
Lrpprc T C 17: 84,731,189 E950G possibly damaging Het
Lrrc66 T A 5: 73,629,776 probably null Het
Mtbp T C 15: 55,609,521 V627A probably benign Het
Myo10 T A 15: 25,726,415 probably null Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nipbl T C 15: 8,338,934 N1142S probably benign Het
Nrxn2 G A 19: 6,532,143 V660I probably damaging Het
Oas1c T C 5: 120,808,139 E98G probably damaging Het
Olfr160 T G 9: 37,711,698 I194L probably benign Het
Otx1 A G 11: 21,996,638 probably benign Het
Prkcd A G 14: 30,601,197 F461L probably damaging Het
Prune2 T C 19: 17,003,734 F85S possibly damaging Het
Rnf214 G A 9: 45,871,912 R184W probably damaging Het
Scn5a T C 9: 119,495,778 N1328S probably damaging Het
Secisbp2l T C 2: 125,751,883 probably benign Het
Smarcal1 A G 1: 72,626,689 probably benign Het
Snx21 T C 2: 164,786,850 Y138H probably damaging Het
Sox5 T A 6: 144,116,480 R149W probably damaging Het
Spout1 C T 2: 30,177,577 probably benign Het
Tlr1 A G 5: 64,927,202 C11R possibly damaging Het
Vmn2r23 A T 6: 123,729,738 H509L probably benign Het
Other mutations in Il23r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00668:Il23r APN 6 67423628 missense probably damaging 0.96
IGL00886:Il23r APN 6 67473890 missense possibly damaging 0.94
IGL00916:Il23r APN 6 67473931 missense probably damaging 1.00
IGL01102:Il23r APN 6 67423925 missense probably damaging 0.98
IGL01466:Il23r APN 6 67426642 missense probably benign 0.30
IGL01627:Il23r APN 6 67423428 missense probably benign 0.17
IGL02160:Il23r APN 6 67423578 missense probably benign 0.09
IGL02394:Il23r APN 6 67466272 splice site probably benign
IGL02418:Il23r APN 6 67490672 missense possibly damaging 0.46
IGL02818:Il23r APN 6 67486094 critical splice donor site probably null
IGL03230:Il23r APN 6 67423964 missense probably benign 0.31
R0029:Il23r UTSW 6 67478945 critical splice donor site probably null
R0029:Il23r UTSW 6 67478945 critical splice donor site probably null
R0035:Il23r UTSW 6 67473788 splice site probably benign
R0035:Il23r UTSW 6 67473788 splice site probably benign
R0085:Il23r UTSW 6 67486222 missense probably damaging 1.00
R0477:Il23r UTSW 6 67452377 missense probably benign 0.00
R0534:Il23r UTSW 6 67426588 missense probably benign 0.00
R0547:Il23r UTSW 6 67423701 missense probably benign 0.05
R0547:Il23r UTSW 6 67486251 missense possibly damaging 0.57
R0666:Il23r UTSW 6 67434680 missense probably benign 0.08
R0702:Il23r UTSW 6 67466285 missense probably damaging 0.97
R0715:Il23r UTSW 6 67486333 missense possibly damaging 0.63
R1077:Il23r UTSW 6 67473810 missense probably benign 0.40
R1202:Il23r UTSW 6 67478953 missense possibly damaging 0.95
R1328:Il23r UTSW 6 67491818 start gained probably benign
R1378:Il23r UTSW 6 67452410 missense possibly damaging 0.68
R1420:Il23r UTSW 6 67486197 missense probably damaging 1.00
R1475:Il23r UTSW 6 67452296 critical splice donor site probably null
R1628:Il23r UTSW 6 67423609 missense probably damaging 1.00
R1745:Il23r UTSW 6 67466291 missense probably damaging 0.98
R1887:Il23r UTSW 6 67473801 missense possibly damaging 0.88
R1901:Il23r UTSW 6 67423734 missense probably benign 0.44
R1902:Il23r UTSW 6 67423734 missense probably benign 0.44
R1928:Il23r UTSW 6 67423735 missense possibly damaging 0.79
R1984:Il23r UTSW 6 67490668 splice site probably null
R1985:Il23r UTSW 6 67490668 splice site probably null
R2264:Il23r UTSW 6 67426667 critical splice acceptor site probably null
R2290:Il23r UTSW 6 67423861 missense probably benign 0.17
R2363:Il23r UTSW 6 67452417 missense probably benign 0.08
R3430:Il23r UTSW 6 67452474 missense probably benign 0.08
R3964:Il23r UTSW 6 67466297 missense probably benign 0.13
R4073:Il23r UTSW 6 67486122 missense probably damaging 1.00
R4643:Il23r UTSW 6 67423993 missense probably benign 0.08
R4700:Il23r UTSW 6 67473850 missense probably damaging 1.00
R4703:Il23r UTSW 6 67490702 missense probably damaging 1.00
R4720:Il23r UTSW 6 67423661 missense probably damaging 1.00
R4828:Il23r UTSW 6 67431651 missense probably benign 0.31
R4911:Il23r UTSW 6 67423561 missense probably benign 0.17
R5119:Il23r UTSW 6 67466316 missense probably damaging 1.00
R5152:Il23r UTSW 6 67423741 missense probably damaging 0.98
R5223:Il23r UTSW 6 67486170 missense probably benign 0.23
R5271:Il23r UTSW 6 67423696 missense probably benign 0.16
R5330:Il23r UTSW 6 67423495 missense probably damaging 1.00
R5331:Il23r UTSW 6 67423495 missense probably damaging 1.00
R5384:Il23r UTSW 6 67486291 missense probably benign 0.10
R5874:Il23r UTSW 6 67431645 missense possibly damaging 0.92
R6037:Il23r UTSW 6 67478954 missense probably damaging 0.99
R6037:Il23r UTSW 6 67478954 missense probably damaging 0.99
R6377:Il23r UTSW 6 67423652 missense probably damaging 0.99
R6925:Il23r UTSW 6 67423493 missense probably damaging 1.00
R6975:Il23r UTSW 6 67423368 missense probably damaging 1.00
R7529:Il23r UTSW 6 67490736 missense possibly damaging 0.84
R7757:Il23r UTSW 6 67423981 missense probably benign 0.02
R7832:Il23r UTSW 6 67423862 missense probably benign 0.08
R7946:Il23r UTSW 6 67434664 missense possibly damaging 0.69
R8078:Il23r UTSW 6 67423593 missense probably damaging 0.99
R8391:Il23r UTSW 6 67452390 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- AGACAACAGAGTCTGCGCTG -3'
(R):5'- AAGGCTCACAGGACTCCTTGAG -3'

Sequencing Primer
(F):5'- CTGCGCTGGGATAGTTTCAC -3'
(R):5'- CTTGAGACAAGAGACTGTCCTCTAG -3'
Posted On2015-06-12