Incidental Mutation 'R4164:Cntn5'
ID321660
Institutional Source Beutler Lab
Gene Symbol Cntn5
Ensembl Gene ENSMUSG00000039488
Gene Namecontactin 5
SynonymsNB-2, LOC244683, 6720426O10Rik, A830025P08Rik
MMRRC Submission 041638-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4164 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location9660891-10904775 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9781676 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 666 (V666A)
Ref Sequence ENSEMBL: ENSMUSP00000124327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074133] [ENSMUST00000160216] [ENSMUST00000162484] [ENSMUST00000179049]
Predicted Effect probably damaging
Transcript: ENSMUST00000074133
AA Change: V666A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073769
Gene: ENSMUSG00000039488
AA Change: V666A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IGc2 113 179 1.11e-10 SMART
IG 201 289 4.82e-6 SMART
IGc2 312 375 1.4e-16 SMART
IGc2 401 464 8.97e-15 SMART
IGc2 493 557 4.96e-8 SMART
IG 577 667 2.13e-7 SMART
FN3 670 756 1.01e-11 SMART
FN3 773 859 9.19e-1 SMART
FN3 875 958 3.99e-10 SMART
FN3 974 1053 1.68e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160216
AA Change: V666A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124327
Gene: ENSMUSG00000039488
AA Change: V666A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IGc2 113 179 1.11e-10 SMART
IG 201 289 4.82e-6 SMART
IGc2 312 375 1.4e-16 SMART
IGc2 401 464 8.97e-15 SMART
IGc2 493 557 4.96e-8 SMART
IG 577 667 2.13e-7 SMART
FN3 670 756 1.01e-11 SMART
FN3 773 859 9.19e-1 SMART
FN3 875 958 3.99e-10 SMART
FN3 974 1053 1.68e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162484
AA Change: V461A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124214
Gene: ENSMUSG00000039488
AA Change: V461A

DomainStartEndE-ValueType
IG_like 10 84 1.12e2 SMART
IGc2 107 170 1.4e-16 SMART
IGc2 196 259 8.97e-15 SMART
IGc2 288 352 4.96e-8 SMART
IG 372 462 2.13e-7 SMART
FN3 465 551 1.01e-11 SMART
FN3 568 654 9.19e-1 SMART
FN3 670 753 3.99e-10 SMART
FN3 769 848 1.68e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179049
AA Change: V461A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135903
Gene: ENSMUSG00000039488
AA Change: V461A

DomainStartEndE-ValueType
IG_like 10 84 1.12e2 SMART
IGc2 107 170 1.4e-16 SMART
IGc2 196 259 8.97e-15 SMART
IGc2 288 352 4.96e-8 SMART
IG 372 462 2.13e-7 SMART
FN3 465 551 1.01e-11 SMART
FN3 568 654 9.19e-1 SMART
FN3 670 753 3.99e-10 SMART
FN3 769 848 1.68e-3 SMART
Meta Mutation Damage Score 0.4868 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 89% (40/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily, and contactin family, which mediate cell surface interactions during nervous system development. This protein is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice are viable, fertile, and less susceptible to audiogenic seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 C T 11: 69,890,037 A164T probably benign Het
Ash1l A G 3: 88,981,966 D384G probably damaging Het
Defb41 C T 1: 18,260,597 C42Y probably damaging Het
Dennd4c C A 4: 86,807,527 N739K probably benign Het
Dnah6 C T 6: 73,089,592 W2598* probably null Het
Ell G T 8: 70,581,573 R30L probably damaging Het
Fam189a2 G A 19: 23,975,629 A439V probably damaging Het
Fam189a2 C T 19: 23,975,638 S436N probably damaging Het
Fer1l6 A C 15: 58,559,238 R247S possibly damaging Het
Flnb A T 14: 7,915,374 I1502F possibly damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm2223 C T X: 33,505,784 noncoding transcript Het
Ifi203 A T 1: 173,928,463 probably benign Het
Ighm T A 12: 113,422,295 E108V unknown Het
Il23r T A 6: 67,423,663 Q561L probably benign Het
Kank1 A G 19: 25,411,072 D703G probably benign Het
Kcnt2 A T 1: 140,609,630 Y1109F probably damaging Het
Lamb2 T A 9: 108,490,298 Y1760N probably damaging Het
Lrpprc T C 17: 84,731,189 E950G possibly damaging Het
Lrrc66 T A 5: 73,629,776 probably null Het
Mtbp T C 15: 55,609,521 V627A probably benign Het
Myo10 T A 15: 25,726,415 probably null Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nipbl T C 15: 8,338,934 N1142S probably benign Het
Nrxn2 G A 19: 6,532,143 V660I probably damaging Het
Oas1c T C 5: 120,808,139 E98G probably damaging Het
Olfr160 T G 9: 37,711,698 I194L probably benign Het
Otx1 A G 11: 21,996,638 probably benign Het
Prkcd A G 14: 30,601,197 F461L probably damaging Het
Prune2 T C 19: 17,003,734 F85S possibly damaging Het
Rnf214 G A 9: 45,871,912 R184W probably damaging Het
Scn5a T C 9: 119,495,778 N1328S probably damaging Het
Secisbp2l T C 2: 125,751,883 probably benign Het
Smarcal1 A G 1: 72,626,689 probably benign Het
Snx21 T C 2: 164,786,850 Y138H probably damaging Het
Sox5 T A 6: 144,116,480 R149W probably damaging Het
Spout1 C T 2: 30,177,577 probably benign Het
Tlr1 A G 5: 64,927,202 C11R possibly damaging Het
Vmn2r23 A T 6: 123,729,738 H509L probably benign Het
Other mutations in Cntn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Cntn5 APN 9 9976297 missense probably damaging 0.99
IGL01118:Cntn5 APN 9 9831560 missense possibly damaging 0.94
IGL01328:Cntn5 APN 9 9781768 missense probably damaging 1.00
IGL01445:Cntn5 APN 9 9693484 splice site probably benign
IGL01505:Cntn5 APN 9 9706087 missense probably damaging 1.00
IGL01556:Cntn5 APN 9 9673908 missense probably benign
IGL01804:Cntn5 APN 9 9831537 missense probably damaging 0.99
IGL02173:Cntn5 APN 9 9748396 missense probably damaging 1.00
IGL02250:Cntn5 APN 9 10145331 missense probably damaging 1.00
IGL02366:Cntn5 APN 9 9984055 splice site probably benign
IGL02565:Cntn5 APN 9 10145338 nonsense probably null
IGL02593:Cntn5 APN 9 9833499 missense probably damaging 1.00
IGL02743:Cntn5 APN 9 9984110 missense probably damaging 1.00
IGL02976:Cntn5 APN 9 10419099 unclassified probably benign
IGL03103:Cntn5 APN 9 9972812 splice site probably benign
IGL03114:Cntn5 APN 9 9748452 missense probably damaging 1.00
IGL03156:Cntn5 APN 9 9673877 missense probably damaging 1.00
IGL02802:Cntn5 UTSW 9 10048678 splice site probably null
R0243:Cntn5 UTSW 9 9781775 missense probably damaging 1.00
R0385:Cntn5 UTSW 9 9972870 missense probably damaging 1.00
R0541:Cntn5 UTSW 9 9673402 splice site probably benign
R0827:Cntn5 UTSW 9 9666938 missense possibly damaging 0.88
R1029:Cntn5 UTSW 9 9831572 missense probably damaging 1.00
R1440:Cntn5 UTSW 9 10145339 missense probably damaging 1.00
R1463:Cntn5 UTSW 9 9673796 critical splice donor site probably null
R1536:Cntn5 UTSW 9 9976316 missense possibly damaging 0.78
R1746:Cntn5 UTSW 9 9831572 missense probably damaging 1.00
R1761:Cntn5 UTSW 9 10172054 missense probably benign 0.01
R1764:Cntn5 UTSW 9 9673983 missense probably benign
R1859:Cntn5 UTSW 9 9972834 missense probably damaging 1.00
R1888:Cntn5 UTSW 9 9984077 missense possibly damaging 0.95
R1888:Cntn5 UTSW 9 9984077 missense possibly damaging 0.95
R1950:Cntn5 UTSW 9 9781769 missense probably damaging 1.00
R2143:Cntn5 UTSW 9 9748415 missense probably damaging 0.98
R2145:Cntn5 UTSW 9 9748415 missense probably damaging 0.98
R2437:Cntn5 UTSW 9 10048753 nonsense probably null
R2440:Cntn5 UTSW 9 10171955 missense possibly damaging 0.91
R2504:Cntn5 UTSW 9 10172121 missense probably benign
R3054:Cntn5 UTSW 9 10419071 missense probably benign 0.30
R3056:Cntn5 UTSW 9 10419071 missense probably benign 0.30
R3804:Cntn5 UTSW 9 9781663 splice site probably benign
R4444:Cntn5 UTSW 9 9704942 missense probably damaging 1.00
R4472:Cntn5 UTSW 9 10048771 missense probably damaging 1.00
R4576:Cntn5 UTSW 9 9673292 missense probably benign 0.10
R4624:Cntn5 UTSW 9 9704804 nonsense probably null
R4652:Cntn5 UTSW 9 9704912 missense possibly damaging 0.68
R4664:Cntn5 UTSW 9 10144209 missense possibly damaging 0.71
R4679:Cntn5 UTSW 9 9970531 missense probably benign 0.09
R4829:Cntn5 UTSW 9 9976283 missense probably damaging 1.00
R4929:Cntn5 UTSW 9 9976395 critical splice acceptor site probably null
R5211:Cntn5 UTSW 9 9704889 missense possibly damaging 0.88
R5406:Cntn5 UTSW 9 9833460 missense probably damaging 1.00
R5468:Cntn5 UTSW 9 9743628 missense probably damaging 1.00
R5584:Cntn5 UTSW 9 9661452 missense possibly damaging 0.91
R5688:Cntn5 UTSW 9 9748422 missense probably damaging 1.00
R5762:Cntn5 UTSW 9 9748389 missense possibly damaging 0.95
R6141:Cntn5 UTSW 9 10144157 missense probably benign
R6147:Cntn5 UTSW 9 10012889 missense probably damaging 0.98
R6325:Cntn5 UTSW 9 10144323 intron probably null
R6377:Cntn5 UTSW 9 9743652 missense probably damaging 1.00
R6774:Cntn5 UTSW 9 10144217 missense probably damaging 1.00
R7117:Cntn5 UTSW 9 10904699 start gained probably benign
R7252:Cntn5 UTSW 9 9831635 missense probably benign 0.00
R7363:Cntn5 UTSW 9 10172016 missense probably benign 0.00
R7401:Cntn5 UTSW 9 9833461 missense probably benign 0.13
R7488:Cntn5 UTSW 9 9970565 missense probably damaging 0.99
R7548:Cntn5 UTSW 9 9673410 intron probably null
R7662:Cntn5 UTSW 9 9661385 missense probably benign 0.17
R7718:Cntn5 UTSW 9 9984128 missense probably benign
R7719:Cntn5 UTSW 9 9704898 missense probably damaging 1.00
R7788:Cntn5 UTSW 9 9704929 missense probably benign 0.01
R7864:Cntn5 UTSW 9 9984177 missense probably damaging 0.98
R7947:Cntn5 UTSW 9 9984177 missense probably damaging 0.98
R8117:Cntn5 UTSW 9 9673950 missense probably benign 0.33
Z1177:Cntn5 UTSW 9 9673962 nonsense probably null
Z1177:Cntn5 UTSW 9 10090236 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTGCTTCTAAAGAGGTTTG -3'
(R):5'- AAACAGGCCCTTTGAATATGCG -3'

Sequencing Primer
(F):5'- GCTATATCATCATCTCAAAGGCAAG -3'
(R):5'- CAGGCCCTTTGAATATGCGAAGTTC -3'
Posted On2015-06-12