Incidental Mutation 'R4164:Acap1'
ID321666
Institutional Source Beutler Lab
Gene Symbol Acap1
Ensembl Gene ENSMUSG00000001588
Gene NameArfGAP with coiled-coil, ankyrin repeat and PH domains 1
SynonymsCentb1
MMRRC Submission 041638-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4164 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location69881567-69895539 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 69890037 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 164 (A164T)
Ref Sequence ENSEMBL: ENSMUSP00000001631 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001631] [ENSMUST00000108622]
Predicted Effect probably benign
Transcript: ENSMUST00000001631
AA Change: A164T

PolyPhen 2 Score 0.217 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000001631
Gene: ENSMUSG00000001588
AA Change: A164T

DomainStartEndE-ValueType
Pfam:BAR_3 5 240 2.1e-68 PFAM
PH 266 362 4.42e-15 SMART
ArfGap 405 527 2.42e-50 SMART
ANK 606 635 4.01e0 SMART
ANK 639 668 3.04e0 SMART
ANK 672 702 4.18e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108622
SMART Domains Protein: ENSMUSP00000104262
Gene: ENSMUSG00000001588

DomainStartEndE-ValueType
PH 78 174 4.42e-15 SMART
ArfGap 217 339 2.42e-50 SMART
ANK 418 447 4.01e0 SMART
ANK 451 480 3.04e0 SMART
ANK 484 514 4.18e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148037
Meta Mutation Damage Score 0.1019 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 89% (40/45)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ash1l A G 3: 88,981,966 D384G probably damaging Het
Cntn5 A G 9: 9,781,676 V666A probably damaging Het
Defb41 C T 1: 18,260,597 C42Y probably damaging Het
Dennd4c C A 4: 86,807,527 N739K probably benign Het
Dnah6 C T 6: 73,089,592 W2598* probably null Het
Ell G T 8: 70,581,573 R30L probably damaging Het
Fam189a2 G A 19: 23,975,629 A439V probably damaging Het
Fam189a2 C T 19: 23,975,638 S436N probably damaging Het
Fer1l6 A C 15: 58,559,238 R247S possibly damaging Het
Flnb A T 14: 7,915,374 I1502F possibly damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm2223 C T X: 33,505,784 noncoding transcript Het
Ifi203 A T 1: 173,928,463 probably benign Het
Ighm T A 12: 113,422,295 E108V unknown Het
Il23r T A 6: 67,423,663 Q561L probably benign Het
Kank1 A G 19: 25,411,072 D703G probably benign Het
Kcnt2 A T 1: 140,609,630 Y1109F probably damaging Het
Lamb2 T A 9: 108,490,298 Y1760N probably damaging Het
Lrpprc T C 17: 84,731,189 E950G possibly damaging Het
Lrrc66 T A 5: 73,629,776 probably null Het
Mtbp T C 15: 55,609,521 V627A probably benign Het
Myo10 T A 15: 25,726,415 probably null Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nipbl T C 15: 8,338,934 N1142S probably benign Het
Nrxn2 G A 19: 6,532,143 V660I probably damaging Het
Oas1c T C 5: 120,808,139 E98G probably damaging Het
Olfr160 T G 9: 37,711,698 I194L probably benign Het
Otx1 A G 11: 21,996,638 probably benign Het
Prkcd A G 14: 30,601,197 F461L probably damaging Het
Prune2 T C 19: 17,003,734 F85S possibly damaging Het
Rnf214 G A 9: 45,871,912 R184W probably damaging Het
Scn5a T C 9: 119,495,778 N1328S probably damaging Het
Secisbp2l T C 2: 125,751,883 probably benign Het
Smarcal1 A G 1: 72,626,689 probably benign Het
Snx21 T C 2: 164,786,850 Y138H probably damaging Het
Sox5 T A 6: 144,116,480 R149W probably damaging Het
Spout1 C T 2: 30,177,577 probably benign Het
Tlr1 A G 5: 64,927,202 C11R possibly damaging Het
Vmn2r23 A T 6: 123,729,738 H509L probably benign Het
Other mutations in Acap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Acap1 APN 11 69882691 missense possibly damaging 0.95
IGL01148:Acap1 APN 11 69890903 nonsense probably null
IGL01398:Acap1 APN 11 69881722 missense probably damaging 1.00
IGL01583:Acap1 APN 11 69881677 missense probably damaging 1.00
IGL02002:Acap1 APN 11 69884460 missense probably damaging 1.00
IGL02078:Acap1 APN 11 69895286 missense probably damaging 1.00
IGL02083:Acap1 APN 11 69889510 missense possibly damaging 0.74
IGL02535:Acap1 APN 11 69882694 missense probably benign 0.02
IGL02669:Acap1 APN 11 69894595 unclassified probably benign
IGL03125:Acap1 APN 11 69887038 missense probably damaging 1.00
Autobot UTSW 11 69881722 missense probably damaging 1.00
R0127:Acap1 UTSW 11 69887217 splice site probably benign
R0243:Acap1 UTSW 11 69885426 missense probably damaging 0.98
R0604:Acap1 UTSW 11 69884625 missense probably benign 0.01
R0863:Acap1 UTSW 11 69887056 missense probably damaging 0.98
R1331:Acap1 UTSW 11 69882376 splice site probably null
R1911:Acap1 UTSW 11 69881722 missense probably damaging 1.00
R1994:Acap1 UTSW 11 69889498 missense probably benign 0.41
R2411:Acap1 UTSW 11 69885485 missense probably damaging 1.00
R2442:Acap1 UTSW 11 69889491 missense possibly damaging 0.46
R2910:Acap1 UTSW 11 69887076 splice site probably benign
R4223:Acap1 UTSW 11 69883685 missense probably damaging 0.99
R4562:Acap1 UTSW 11 69885351 intron probably benign
R4676:Acap1 UTSW 11 69889468 missense probably benign 0.22
R4852:Acap1 UTSW 11 69884376 missense probably benign 0.30
R4921:Acap1 UTSW 11 69887193 missense probably damaging 0.98
R4928:Acap1 UTSW 11 69885815 missense possibly damaging 0.81
R5536:Acap1 UTSW 11 69889307 missense probably benign 0.11
R5886:Acap1 UTSW 11 69884336 missense probably benign
R6053:Acap1 UTSW 11 69887070 critical splice acceptor site probably null
R6196:Acap1 UTSW 11 69887067 missense probably damaging 0.98
R6220:Acap1 UTSW 11 69889679 missense probably damaging 0.99
R6295:Acap1 UTSW 11 69890587 critical splice donor site probably null
R6333:Acap1 UTSW 11 69883601 missense possibly damaging 0.65
R6414:Acap1 UTSW 11 69884336 missense probably benign
R6848:Acap1 UTSW 11 69884661 missense probably damaging 1.00
R6952:Acap1 UTSW 11 69885517 missense probably benign 0.30
R7243:Acap1 UTSW 11 69890471 missense probably benign 0.21
R8066:Acap1 UTSW 11 69889863 missense probably benign 0.05
X0012:Acap1 UTSW 11 69881689 missense probably damaging 1.00
X0027:Acap1 UTSW 11 69881723 missense probably damaging 1.00
Z1177:Acap1 UTSW 11 69882443 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGACCTGAAGGCCCCAAAAG -3'
(R):5'- GATAGGTGGGCCTTATCCTGAG -3'

Sequencing Primer
(F):5'- TGAAGGCCCCAAAAGACCTCAG -3'
(R):5'- TTCCTAAAGCAGAAGGGTAAATCTG -3'
Posted On2015-06-12