Incidental Mutation 'R4164:Ighm'
ID321667
Institutional Source Beutler Lab
Gene Symbol Ighm
Ensembl Gene ENSMUSG00000076617
Gene Nameimmunoglobulin heavy constant mu
SynonymsmuH, IgM, Igh6, Igh-M, Ig mu
MMRRC Submission 041638-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R4164 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location113418558-113422730 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 113422295 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 108 (E108V)
Gene Model predicted gene model for transcript(s):
Predicted Effect unknown
Transcript: ENSMUST00000103426
AA Change: E108V
SMART Domains Protein: ENSMUSP00000100222
Gene: ENSMUSG00000076617
AA Change: E108V

DomainStartEndE-ValueType
IG_like 23 99 1.94e-2 SMART
IGc1 131 209 2.37e-14 SMART
IG_like 241 315 1.6e-2 SMART
IGc1 348 425 1.94e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174942
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175007
Predicted Effect unknown
Transcript: ENSMUST00000177715
AA Change: E108V
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196624
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 89% (40/45)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal immune system morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 C T 11: 69,890,037 A164T probably benign Het
Ash1l A G 3: 88,981,966 D384G probably damaging Het
Cntn5 A G 9: 9,781,676 V666A probably damaging Het
Defb41 C T 1: 18,260,597 C42Y probably damaging Het
Dennd4c C A 4: 86,807,527 N739K probably benign Het
Dnah6 C T 6: 73,089,592 W2598* probably null Het
Ell G T 8: 70,581,573 R30L probably damaging Het
Fam189a2 G A 19: 23,975,629 A439V probably damaging Het
Fam189a2 C T 19: 23,975,638 S436N probably damaging Het
Fer1l6 A C 15: 58,559,238 R247S possibly damaging Het
Flnb A T 14: 7,915,374 I1502F possibly damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm2223 C T X: 33,505,784 noncoding transcript Het
Ifi203 A T 1: 173,928,463 probably benign Het
Il23r T A 6: 67,423,663 Q561L probably benign Het
Kank1 A G 19: 25,411,072 D703G probably benign Het
Kcnt2 A T 1: 140,609,630 Y1109F probably damaging Het
Lamb2 T A 9: 108,490,298 Y1760N probably damaging Het
Lrpprc T C 17: 84,731,189 E950G possibly damaging Het
Lrrc66 T A 5: 73,629,776 probably null Het
Mtbp T C 15: 55,609,521 V627A probably benign Het
Myo10 T A 15: 25,726,415 probably null Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nipbl T C 15: 8,338,934 N1142S probably benign Het
Nrxn2 G A 19: 6,532,143 V660I probably damaging Het
Oas1c T C 5: 120,808,139 E98G probably damaging Het
Olfr160 T G 9: 37,711,698 I194L probably benign Het
Otx1 A G 11: 21,996,638 probably benign Het
Prkcd A G 14: 30,601,197 F461L probably damaging Het
Prune2 T C 19: 17,003,734 F85S possibly damaging Het
Rnf214 G A 9: 45,871,912 R184W probably damaging Het
Scn5a T C 9: 119,495,778 N1328S probably damaging Het
Secisbp2l T C 2: 125,751,883 probably benign Het
Smarcal1 A G 1: 72,626,689 probably benign Het
Snx21 T C 2: 164,786,850 Y138H probably damaging Het
Sox5 T A 6: 144,116,480 R149W probably damaging Het
Spout1 C T 2: 30,177,577 probably benign Het
Tlr1 A G 5: 64,927,202 C11R possibly damaging Het
Vmn2r23 A T 6: 123,729,738 H509L probably benign Het
Other mutations in Ighm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Ighm APN 12 113421234 unclassified probably benign
IGL01775:Ighm APN 12 113422467 missense unknown
IGL02069:Ighm APN 12 113421148 unclassified probably benign
IGL03124:Ighm APN 12 113421638 missense unknown
manifest UTSW 12 113421253 nonsense probably null
R3055:Ighm UTSW 12 113418976 unclassified probably benign
R3056:Ighm UTSW 12 113418976 unclassified probably benign
R4475:Ighm UTSW 12 113420893 unclassified probably benign
R4871:Ighm UTSW 12 113421621 missense unknown
R5542:Ighm UTSW 12 113418981 unclassified probably benign
R5738:Ighm UTSW 12 113421495 missense unknown
R5856:Ighm UTSW 12 113421602 missense unknown
R5946:Ighm UTSW 12 113422709 missense unknown
R6267:Ighm UTSW 12 113421567 missense unknown
R6296:Ighm UTSW 12 113421567 missense unknown
R7409:Ighm UTSW 12 113422232 missense
R7492:Ighm UTSW 12 113422673 missense
R7898:Ighm UTSW 12 113421253 nonsense probably null
R8089:Ighm UTSW 12 113421234 unclassified probably benign
R8301:Ighm UTSW 12 113421545 missense
Predicted Primers PCR Primer
(F):5'- TTGTTCTCGATGGTCACCG -3'
(R):5'- TCTCCCAAGAGCATCCTTGAAG -3'

Sequencing Primer
(F):5'- TCTCGATGGTCACCGGATCTG -3'
(R):5'- CCTTGAAGGTTCAGATGAATACCTGG -3'
Posted On2015-06-12