Mutagenetix > Incidental Mutation

Incidental Mutation 'R4164:Fer1l6'

321674

Institutional Source

Beutler Lab

Gene Symbol

Fer1l6

Ensembl Gene

ENSMUSG00000037106

Gene Name

fer-1-like 6 (C. elegans)

Synonyms

EG631797

MMRRC Submission

041638-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.073) question?

Stock #

R4164 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

58510048-58665092 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 58559238 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 247 (R247S)

Ref Sequence

ENSEMBL: ENSMUSP00000125718 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000161028]

AlphaFold

E0CZ42

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161028
AA Change: R247S

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000125718
Gene: ENSMUSG00000037106
AA Change: R247S

Domain	Start	End	E-Value	Type
low complexity region	4	20	N/A	INTRINSIC
C2	83	179	4.09e-12	SMART
FerI	165	235	2.06e-36	SMART
C2	243	354	5.19e-14	SMART
low complexity region	412	449	N/A	INTRINSIC
FerB	714	787	2.53e-45	SMART
C2	829	936	8.84e-8	SMART
C2	1000	1099	3.05e0	SMART
low complexity region	1189	1203	N/A	INTRINSIC
low complexity region	1256	1270	N/A	INTRINSIC
C2	1361	1460	5.78e-12	SMART
low complexity region	1518	1529	N/A	INTRINSIC
C2	1601	1731	1.01e-2	SMART
Pfam:Ferlin_C	1765	1857	2.3e-40	PFAM

Meta Mutation Damage Score

0.1625

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

89% (40/45)

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acap1	C	T	11: 69,890,037	A164T	probably benign	Het
Ash1l	A	G	3: 88,981,966	D384G	probably damaging	Het
Cntn5	A	G	9: 9,781,676	V666A	probably damaging	Het
Defb41	C	T	1: 18,260,597	C42Y	probably damaging	Het
Dennd4c	C	A	4: 86,807,527	N739K	probably benign	Het
Dnah6	C	T	6: 73,089,592	W2598*	probably null	Het
Ell	G	T	8: 70,581,573	R30L	probably damaging	Het
Fam189a2	G	A	19: 23,975,629	A439V	probably damaging	Het
Fam189a2	C	T	19: 23,975,638	S436N	probably damaging	Het
Flnb	A	T	14: 7,915,374	I1502F	possibly damaging	Het
Gkn3	C	T	6: 87,383,525	A163T	probably damaging	Het
Gm2223	C	T	X: 33,505,784		noncoding transcript	Het
Ifi203	A	T	1: 173,928,463		probably benign	Het
Ighm	T	A	12: 113,422,295	E108V	unknown	Het
Il23r	T	A	6: 67,423,663	Q561L	probably benign	Het
Kank1	A	G	19: 25,411,072	D703G	probably benign	Het
Kcnt2	A	T	1: 140,609,630	Y1109F	probably damaging	Het
Lamb2	T	A	9: 108,490,298	Y1760N	probably damaging	Het
Lrpprc	T	C	17: 84,731,189	E950G	possibly damaging	Het
Lrrc66	T	A	5: 73,629,776		probably null	Het
Mtbp	T	C	15: 55,609,521	V627A	probably benign	Het
Myo10	T	A	15: 25,726,415		probably null	Het
Nfix	CAAAAA	CAAAA	8: 84,716,247		probably null	Het
Nipbl	T	C	15: 8,338,934	N1142S	probably benign	Het
Nrxn2	G	A	19: 6,532,143	V660I	probably damaging	Het
Oas1c	T	C	5: 120,808,139	E98G	probably damaging	Het
Olfr160	T	G	9: 37,711,698	I194L	probably benign	Het
Otx1	A	G	11: 21,996,638		probably benign	Het
Prkcd	A	G	14: 30,601,197	F461L	probably damaging	Het
Prune2	T	C	19: 17,003,734	F85S	possibly damaging	Het
Rnf214	G	A	9: 45,871,912	R184W	probably damaging	Het
Scn5a	T	C	9: 119,495,778	N1328S	probably damaging	Het
Secisbp2l	T	C	2: 125,751,883		probably benign	Het
Smarcal1	A	G	1: 72,626,689		probably benign	Het
Snx21	T	C	2: 164,786,850	Y138H	probably damaging	Het
Sox5	T	A	6: 144,116,480	R149W	probably damaging	Het
Spout1	C	T	2: 30,177,577		probably benign	Het
Tlr1	A	G	5: 64,927,202	C11R	possibly damaging	Het
Vmn2r23	A	T	6: 123,729,738	H509L	probably benign	Het

Other mutations in Fer1l6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0009:Fer1l6	UTSW	15	58662787	missense	probably damaging	1.00
R0141:Fer1l6	UTSW	15	58558402	missense	probably damaging	1.00
R0178:Fer1l6	UTSW	15	58637914	splice site	probably null
R0304:Fer1l6	UTSW	15	58590562	missense	probably benign	0.08
R0379:Fer1l6	UTSW	15	58548338	missense	probably benign	0.05
R0457:Fer1l6	UTSW	15	58638094	critical splice donor site	probably null
R0546:Fer1l6	UTSW	15	58558408	splice site	probably null
R0602:Fer1l6	UTSW	15	58577945	missense	probably damaging	0.98
R0619:Fer1l6	UTSW	15	58662935	splice site	probably null
R0669:Fer1l6	UTSW	15	58553724	splice site	probably null
R0854:Fer1l6	UTSW	15	58559188	missense	probably benign	0.00
R0948:Fer1l6	UTSW	15	58564075	missense	probably benign	0.00
R1180:Fer1l6	UTSW	15	58602311	splice site	probably benign
R1483:Fer1l6	UTSW	15	58637970	missense	possibly damaging	0.84
R1627:Fer1l6	UTSW	15	58641879	missense	probably benign	0.41
R1635:Fer1l6	UTSW	15	58647081	missense	probably damaging	1.00
R1834:Fer1l6	UTSW	15	58557869	missense	possibly damaging	0.58
R1921:Fer1l6	UTSW	15	58625231	missense	probably damaging	1.00
R2000:Fer1l6	UTSW	15	58602311	splice site	probably benign
R2041:Fer1l6	UTSW	15	58558306	missense	probably damaging	1.00
R2144:Fer1l6	UTSW	15	58627534	missense	probably benign
R2145:Fer1l6	UTSW	15	58627534	missense	probably benign
R2981:Fer1l6	UTSW	15	58564077	missense	probably damaging	0.99
R4192:Fer1l6	UTSW	15	58647149	missense	probably damaging	1.00
R4273:Fer1l6	UTSW	15	58627522	missense	probably benign	0.41
R4573:Fer1l6	UTSW	15	58626280	critical splice donor site	probably null
R4581:Fer1l6	UTSW	15	58640226	missense	probably damaging	1.00
R4624:Fer1l6	UTSW	15	58553705	missense	probably damaging	1.00
R4755:Fer1l6	UTSW	15	58640211	missense	probably benign	0.09
R4774:Fer1l6	UTSW	15	58577949	missense	probably damaging	0.99
R4894:Fer1l6	UTSW	15	58618902	missense	probably damaging	1.00
R4896:Fer1l6	UTSW	15	58638020	missense	probably damaging	1.00
R4921:Fer1l6	UTSW	15	58600311	critical splice acceptor site	probably null
R4962:Fer1l6	UTSW	15	58571401	missense	probably benign	0.03
R5029:Fer1l6	UTSW	15	58643920	missense	probably benign	0.00
R5134:Fer1l6	UTSW	15	58640154	missense	probably damaging	1.00
R5175:Fer1l6	UTSW	15	58550277	missense	probably damaging	1.00
R5227:Fer1l6	UTSW	15	58581903	nonsense	probably null
R5561:Fer1l6	UTSW	15	58660825	missense	probably damaging	0.97
R5621:Fer1l6	UTSW	15	58558326	missense	probably damaging	1.00
R5670:Fer1l6	UTSW	15	58622482	missense	probably benign	0.00
R5745:Fer1l6	UTSW	15	58571389	missense	probably benign	0.01
R5807:Fer1l6	UTSW	15	58590550	nonsense	probably null
R5823:Fer1l6	UTSW	15	58590503	nonsense	probably null
R5892:Fer1l6	UTSW	15	58564068	missense	probably benign
R6006:Fer1l6	UTSW	15	58647044	missense	probably damaging	1.00
R6137:Fer1l6	UTSW	15	58559206	missense	probably damaging	0.97
R6195:Fer1l6	UTSW	15	58637957	missense	probably damaging	1.00
R6234:Fer1l6	UTSW	15	58560639	missense	probably damaging	1.00
R6237:Fer1l6	UTSW	15	58625177	nonsense	probably null
R6237:Fer1l6	UTSW	15	58638006	missense	probably damaging	1.00
R6271:Fer1l6	UTSW	15	58641918	missense	probably benign	0.01
R6336:Fer1l6	UTSW	15	58559232	nonsense	probably null
R6784:Fer1l6	UTSW	15	58571426	missense	possibly damaging	0.63
R6852:Fer1l6	UTSW	15	58594878	missense	probably damaging	1.00
R7030:Fer1l6	UTSW	15	58629378	missense	probably damaging	1.00
R7088:Fer1l6	UTSW	15	58564050	missense	possibly damaging	0.69
R7181:Fer1l6	UTSW	15	58575297	missense	probably benign	0.00
R7226:Fer1l6	UTSW	15	58590535	missense	probably benign	0.00
R7266:Fer1l6	UTSW	15	58627597	missense	probably benign
R7463:Fer1l6	UTSW	15	58573601	nonsense	probably null
R7464:Fer1l6	UTSW	15	58573247	splice site	probably null
R7469:Fer1l6	UTSW	15	58590570	splice site	probably null
R7483:Fer1l6	UTSW	15	58641945	missense	possibly damaging	0.83
R7491:Fer1l6	UTSW	15	58600432	missense	probably damaging	1.00
R7534:Fer1l6	UTSW	15	58638026	missense	probably damaging	1.00
R7562:Fer1l6	UTSW	15	58560482	missense	probably benign	0.00
R7580:Fer1l6	UTSW	15	58558396	missense	probably benign	0.41
R7599:Fer1l6	UTSW	15	58627589	missense	probably benign
R7607:Fer1l6	UTSW	15	58662732	nonsense	probably null
R7677:Fer1l6	UTSW	15	58602290	missense	probably benign	0.00
R8202:Fer1l6	UTSW	15	58630637	missense	probably damaging	1.00
R8261:Fer1l6	UTSW	15	58560496	missense	possibly damaging	0.84
R8847:Fer1l6	UTSW	15	58542163	missense	possibly damaging	0.72
R9022:Fer1l6	UTSW	15	58583480	missense	probably damaging	0.99
R9030:Fer1l6	UTSW	15	58630745	missense	probably damaging	1.00
R9160:Fer1l6	UTSW	15	58643866	missense	possibly damaging	0.94
R9180:Fer1l6	UTSW	15	58622381	missense	probably benign	0.19
R9289:Fer1l6	UTSW	15	58618917	missense	probably damaging	1.00
R9559:Fer1l6	UTSW	15	58557910	missense	possibly damaging	0.88
R9562:Fer1l6	UTSW	15	58618521	missense	possibly damaging	0.70
R9682:Fer1l6	UTSW	15	58550264	missense	probably benign	0.03
R9775:Fer1l6	UTSW	15	58625249	missense	probably benign
X0021:Fer1l6	UTSW	15	58569202	nonsense	probably null
X0027:Fer1l6	UTSW	15	58629340	missense	probably damaging	1.00
X0063:Fer1l6	UTSW	15	58618574	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GATGGACCCCAGTGCTATTC -3'
(R):5'- TGACAAGGTTTTCTCTTAGGCAC -3'

Sequencing Primer
(F):5'- GATGGACCCCAGTGCTATTCTATAC -3'
(R):5'- AAGGTTTTCTCTTAGGCACTTTTAC -3'

Posted On

2015-06-12