Incidental Mutation 'R4164:Lrpprc'
ID321675
Institutional Source Beutler Lab
Gene Symbol Lrpprc
Ensembl Gene ENSMUSG00000024120
Gene Nameleucine-rich PPR-motif containing
Synonyms3110001K13Rik, Lrp130
MMRRC Submission 041638-MU
Accession Numbers

Ncbi RefSeq: NM_028233.2; MGI:1919666

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4164 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location84705247-84790789 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84731189 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 950 (E950G)
Ref Sequence ENSEMBL: ENSMUSP00000107927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112308]
Predicted Effect possibly damaging
Transcript: ENSMUST00000112308
AA Change: E950G

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107927
Gene: ENSMUSG00000024120
AA Change: E950G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 32 50 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Pfam:PPR_3 196 228 9.1e-4 PFAM
Pfam:PPR 197 227 2.3e-4 PFAM
Pfam:PPR_3 231 264 7.9e-6 PFAM
Pfam:PPR 232 262 4e-4 PFAM
Pfam:PPR_3 266 297 9.7e-3 PFAM
internal_repeat_2 391 477 3.13e-7 PROSPERO
Pfam:PPR 750 778 3.4e-4 PFAM
low complexity region 1017 1028 N/A INTRINSIC
internal_repeat_1 1042 1362 1.09e-11 PROSPERO
low complexity region 1366 1375 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160011
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162799
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 89% (40/45)
MGI Phenotype Strain: 3857306; 5438913
Lethality: E10-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a leucine-rich protein that has multiple pentatricopeptide repeats (PPR). The precise role of this protein is unknown but studies suggest it may play a role in cytoskeletal organization, vesicular transport, or in transcriptional regulation of both nuclear and mitochondrial genes. The protein localizes primarily to mitochondria and is predicted to have an N-terminal mitochondrial targeting sequence. Mutations in this gene are associated with the French-Canadian type of Leigh syndrome. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality during organogenesis associated with growth retardation. Mice homozygous for a knock-out allele exhibit embryonic lethality between somite formation and embryo turning. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted(3) Gene trapped(10)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 C T 11: 69,890,037 A164T probably benign Het
Ash1l A G 3: 88,981,966 D384G probably damaging Het
Cntn5 A G 9: 9,781,676 V666A probably damaging Het
Defb41 C T 1: 18,260,597 C42Y probably damaging Het
Dennd4c C A 4: 86,807,527 N739K probably benign Het
Dnah6 C T 6: 73,089,592 W2598* probably null Het
Ell G T 8: 70,581,573 R30L probably damaging Het
Fam189a2 G A 19: 23,975,629 A439V probably damaging Het
Fam189a2 C T 19: 23,975,638 S436N probably damaging Het
Fer1l6 A C 15: 58,559,238 R247S possibly damaging Het
Flnb A T 14: 7,915,374 I1502F possibly damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm2223 C T X: 33,505,784 noncoding transcript Het
Ifi203 A T 1: 173,928,463 probably benign Het
Ighm T A 12: 113,422,295 E108V unknown Het
Il23r T A 6: 67,423,663 Q561L probably benign Het
Kank1 A G 19: 25,411,072 D703G probably benign Het
Kcnt2 A T 1: 140,609,630 Y1109F probably damaging Het
Lamb2 T A 9: 108,490,298 Y1760N probably damaging Het
Lrrc66 T A 5: 73,629,776 probably null Het
Mtbp T C 15: 55,609,521 V627A probably benign Het
Myo10 T A 15: 25,726,415 probably null Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nipbl T C 15: 8,338,934 N1142S probably benign Het
Nrxn2 G A 19: 6,532,143 V660I probably damaging Het
Oas1c T C 5: 120,808,139 E98G probably damaging Het
Olfr160 T G 9: 37,711,698 I194L probably benign Het
Otx1 A G 11: 21,996,638 probably benign Het
Prkcd A G 14: 30,601,197 F461L probably damaging Het
Prune2 T C 19: 17,003,734 F85S possibly damaging Het
Rnf214 G A 9: 45,871,912 R184W probably damaging Het
Scn5a T C 9: 119,495,778 N1328S probably damaging Het
Secisbp2l T C 2: 125,751,883 probably benign Het
Smarcal1 A G 1: 72,626,689 probably benign Het
Snx21 T C 2: 164,786,850 Y138H probably damaging Het
Sox5 T A 6: 144,116,480 R149W probably damaging Het
Spout1 C T 2: 30,177,577 probably benign Het
Tlr1 A G 5: 64,927,202 C11R possibly damaging Het
Vmn2r23 A T 6: 123,729,738 H509L probably benign Het
Other mutations in Lrpprc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Lrpprc APN 17 84750525 missense possibly damaging 0.91
IGL01319:Lrpprc APN 17 84705412 utr 3 prime probably benign
IGL01380:Lrpprc APN 17 84722730 missense probably benign
IGL01560:Lrpprc APN 17 84708119 missense probably benign 0.07
IGL01582:Lrpprc APN 17 84754543 missense probably null 0.00
IGL01996:Lrpprc APN 17 84773270 missense probably benign
IGL02109:Lrpprc APN 17 84726570 nonsense probably null
IGL02163:Lrpprc APN 17 84753472 missense probably damaging 0.97
IGL02248:Lrpprc APN 17 84771467 missense probably damaging 0.99
IGL02503:Lrpprc APN 17 84726339 missense probably benign
IGL02545:Lrpprc APN 17 84775425 missense probably benign
IGL02570:Lrpprc APN 17 84750553 missense probably damaging 1.00
IGL02636:Lrpprc APN 17 84753104 unclassified probably benign
IGL02943:Lrpprc APN 17 84771450 missense probably benign 0.00
IGL03008:Lrpprc APN 17 84751247 missense probably benign 0.05
R6807_Lrpprc_629 UTSW 17 84749103 missense possibly damaging 0.93
P0023:Lrpprc UTSW 17 84726338 missense probably benign 0.00
R0027:Lrpprc UTSW 17 84767007 nonsense probably null
R0027:Lrpprc UTSW 17 84767007 nonsense probably null
R0302:Lrpprc UTSW 17 84740078 missense possibly damaging 0.76
R0389:Lrpprc UTSW 17 84753112 critical splice donor site probably null
R0448:Lrpprc UTSW 17 84770894 missense probably benign 0.09
R1396:Lrpprc UTSW 17 84726303 missense possibly damaging 0.68
R1759:Lrpprc UTSW 17 84740081 missense probably damaging 1.00
R2019:Lrpprc UTSW 17 84752331 missense possibly damaging 0.56
R2169:Lrpprc UTSW 17 84770077 missense probably benign 0.00
R2312:Lrpprc UTSW 17 84773258 missense probably damaging 0.96
R2319:Lrpprc UTSW 17 84726390 missense probably benign
R2568:Lrpprc UTSW 17 84726649 missense probably damaging 1.00
R3013:Lrpprc UTSW 17 84767069 missense probably benign 0.04
R3620:Lrpprc UTSW 17 84770024 missense probably benign 0.01
R3789:Lrpprc UTSW 17 84771528 missense probably benign 0.25
R3848:Lrpprc UTSW 17 84770927 missense probably benign 0.01
R3973:Lrpprc UTSW 17 84770841 critical splice donor site probably null
R4111:Lrpprc UTSW 17 84726338 missense probably benign 0.00
R4331:Lrpprc UTSW 17 84740542 critical splice donor site probably null
R4531:Lrpprc UTSW 17 84712787 missense probably benign 0.01
R4832:Lrpprc UTSW 17 84707156 missense probably benign 0.24
R4947:Lrpprc UTSW 17 84771538 missense probably benign 0.02
R5134:Lrpprc UTSW 17 84751256 missense probably benign 0.00
R5333:Lrpprc UTSW 17 84790393 missense probably benign 0.01
R5950:Lrpprc UTSW 17 84740170 missense possibly damaging 0.86
R5972:Lrpprc UTSW 17 84712822 missense possibly damaging 0.88
R6185:Lrpprc UTSW 17 84767024 missense probably benign
R6253:Lrpprc UTSW 17 84740637 missense probably benign 0.00
R6488:Lrpprc UTSW 17 84751353 missense probably damaging 1.00
R6807:Lrpprc UTSW 17 84749103 missense possibly damaging 0.93
R6911:Lrpprc UTSW 17 84756283 missense possibly damaging 0.67
R6933:Lrpprc UTSW 17 84722703 missense probably benign 0.42
R6955:Lrpprc UTSW 17 84776989 missense probably damaging 0.98
R7448:Lrpprc UTSW 17 84772139 missense probably damaging 0.99
R7727:Lrpprc UTSW 17 84776947 missense probably benign 0.00
R8003:Lrpprc UTSW 17 84752317 missense probably benign 0.01
R8178:Lrpprc UTSW 17 84772147 missense probably damaging 1.00
R8310:Lrpprc UTSW 17 84773096 missense probably damaging 1.00
R8322:Lrpprc UTSW 17 84740068 critical splice donor site probably null
R8389:Lrpprc UTSW 17 84773314 missense possibly damaging 0.79
X0026:Lrpprc UTSW 17 84710662 missense probably benign 0.42
Z1088:Lrpprc UTSW 17 84731784 nonsense probably null
Z1088:Lrpprc UTSW 17 84770500 critical splice acceptor site probably null
Z1176:Lrpprc UTSW 17 84770431 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GGTCAGCTTTGTGGACATCAC -3'
(R):5'- TGACCCTGAGTCTCTTGGTAAAG -3'

Sequencing Primer
(F):5'- GTGGACATCACACAGCAGCTTC -3'
(R):5'- GAGTCTCTTGGTAAAGTTAACCCC -3'
Posted On2015-06-12